Transcript: Human XM_011535443.1

PREDICTED: Homo sapiens adenosine deaminase tRNA specific 2 (ADAT2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADAT2 (134637)
Length:
504
CDS:
93..491

Additional Resources:

NCBI RefSeq record:
XM_011535443.1
NBCI Gene record:
ADAT2 (134637)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535443.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050655 TCCTCGATTGGTGTCGTCAAA pLKO.1 452 CDS 100% 4.950 6.930 N ADAT2 n/a
2 TRCN0000434988 AGAGTCCCTCTGAAGTATTTG pLKO_005 479 CDS 100% 13.200 9.240 N ADAT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535443.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13181 pDONR223 100% 25.9% 16.5% None (many diffs) n/a
2 ccsbBroad304_13181 pLX_304 0% 25.9% 16.5% V5 (many diffs) n/a
3 TRCN0000473522 ACCTGGATCCAGCGCTCGGTCCGC pLX_317 94.6% 25.9% 16.5% V5 (many diffs) n/a
Download CSV