Transcript: Human XM_011535453.1

PREDICTED: Homo sapiens syntaxin binding protein 5 (STXBP5), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STXBP5 (134957)
Length:
9073
CDS:
935..3355

Additional Resources:

NCBI RefSeq record:
XM_011535453.1
NBCI Gene record:
STXBP5 (134957)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422190 GGGCACTGAACGAGGTAATAT pLKO_005 329 5UTR 100% 15.000 21.000 N STXBP5 n/a
2 TRCN0000419981 GCACTCGAAATGGAGTATATG pLKO_005 3533 3UTR 100% 13.200 18.480 N STXBP5 n/a
3 TRCN0000430495 TTAGGAAAGTTAACGTTAAAG pLKO_005 3422 3UTR 100% 13.200 18.480 N STXBP5 n/a
4 TRCN0000429624 GATGCTTGAAGTTCGATTATT pLKO_005 1570 CDS 100% 15.000 12.000 N STXBP5 n/a
5 TRCN0000434611 GTCATTGGACTGGATTATAAA pLKO_005 3788 3UTR 100% 15.000 12.000 N STXBP5 n/a
6 TRCN0000415572 GGAGCCTTGCACAGCATATTC pLKO_005 3123 CDS 100% 13.200 10.560 N STXBP5 n/a
7 TRCN0000148758 CCTCCTCTTCTCAGGAAATTA pLKO.1 2607 CDS 100% 15.000 10.500 N STXBP5 n/a
8 TRCN0000146927 CCTGGATCATTCCTGTATTAA pLKO.1 3657 3UTR 100% 15.000 10.500 N STXBP5 n/a
9 TRCN0000431626 TGCAATAACTCTACAAGTATT pLKO_005 1345 CDS 100% 13.200 9.240 N STXBP5 n/a
10 TRCN0000146824 CCAGGTTATCAAACAGAACTA pLKO.1 1778 CDS 100% 4.950 3.465 N STXBP5 n/a
11 TRCN0000149723 GCCAAGTTTAAGACCTCTGTT pLKO.1 2818 CDS 100% 4.950 3.465 N STXBP5 n/a
12 TRCN0000149119 GCACAATCTCTTGACAGAGAA pLKO.1 3065 CDS 100% 0.495 0.347 N STXBP5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535453.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09557 pDONR223 100% 69.2% 69.2% None 0_1ins987;1159_1218del;2358A>G n/a
2 ccsbBroad304_09557 pLX_304 0% 69.2% 69.2% V5 0_1ins987;1159_1218del;2358A>G n/a
3 ccsbBroadEn_16093 pDONR223 0% 69.1% 69.1% None (many diffs) n/a
4 ccsbBroad304_16093 pLX_304 0% 69.1% 69.1% V5 (many diffs) n/a
Download CSV