Transcript: Human XM_011535798.3

PREDICTED: Homo sapiens nucleoporin 43 (NUP43), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUP43 (348995)
Length:
1464
CDS:
26..1069

Additional Resources:

NCBI RefSeq record:
XM_011535798.3
NBCI Gene record:
NUP43 (348995)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535798.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137417 GCAGATAGTAGTACACTCCAT pLKO.1 533 CDS 100% 2.640 3.696 N NUP43 n/a
2 TRCN0000292216 GCAGATAGTAGTACACTCCAT pLKO_005 533 CDS 100% 2.640 3.696 N NUP43 n/a
3 TRCN0000137036 CACTGTGGTCTATTGGAGATT pLKO.1 159 CDS 100% 4.950 3.465 N NUP43 n/a
4 TRCN0000134269 GACCATCAGTTATTGTGTGAT pLKO.1 215 CDS 100% 4.950 3.465 N NUP43 n/a
5 TRCN0000297965 GACCATCAGTTATTGTGTGAT pLKO_005 215 CDS 100% 4.950 3.465 N NUP43 n/a
6 TRCN0000136701 GCCAAGATGGAATGTTGAGTA pLKO.1 735 CDS 100% 4.950 3.465 N NUP43 n/a
7 TRCN0000137797 GCTACAGGATCTTGGGACAAT pLKO.1 122 CDS 100% 4.950 3.465 N NUP43 n/a
8 TRCN0000134068 GCTGTAAGAACCATAGACAAT pLKO.1 512 CDS 100% 4.950 3.465 N NUP43 n/a
9 TRCN0000137855 GCTTCCACAGATGTACCTGAA pLKO.1 896 CDS 100% 4.050 2.835 N NUP43 n/a
10 TRCN0000134871 CCAAGATGGAATGTTGAGTAT pLKO.1 736 CDS 100% 4.950 2.970 N NUP43 n/a
11 TRCN0000164834 CAAACTCCTGAGCTCAAGCAA pLKO.1 973 CDS 100% 3.000 1.500 Y LINC00336 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1414 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535798.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05518 pDONR223 100% 86.2% 82.5% None (many diffs) n/a
2 ccsbBroad304_05518 pLX_304 0% 86.2% 82.5% V5 (many diffs) n/a
3 TRCN0000467607 CCTAACTCCGCTCCAAGGCTAGCG pLX_317 39.2% 86.2% 82.5% V5 (many diffs) n/a
Download CSV