Transcript: Human XM_011535834.3

PREDICTED: Homo sapiens mannosidase alpha class 1A member 1 (MAN1A1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAN1A1 (4121)
Length:
1461
CDS:
67..1350

Additional Resources:

NCBI RefSeq record:
XM_011535834.3
NBCI Gene record:
MAN1A1 (4121)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535834.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359778 GACTACTCTCAGCCTACTATC pLKO_005 1178 CDS 100% 10.800 7.560 N MAN1A1 n/a
2 TRCN0000055383 CGAAAGAAAGCAGTGGAACTT pLKO.1 1219 CDS 100% 4.950 3.465 N Man1a n/a
3 TRCN0000049601 GCTGGTATTCAGCGCCTTCAT pLKO.1 450 CDS 100% 4.950 3.465 N MAN1A1 n/a
4 TRCN0000049602 GTAACATCAAAGGAGCAACTA pLKO.1 1016 CDS 100% 4.950 3.465 N MAN1A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535834.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10957 pDONR223 100% 76.4% 76.4% None 1_249del;850_851ins69 n/a
2 ccsbBroad304_10957 pLX_304 0% 76.4% 76.4% V5 1_249del;850_851ins69 n/a
Download CSV