Transcript: Human XM_011535863.1

PREDICTED: Homo sapiens parkin RBR E3 ubiquitin protein ligase (PRKN), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRKN (5071)
Length:
4211
CDS:
135..1529

Additional Resources:

NCBI RefSeq record:
XM_011535863.1
NBCI Gene record:
PRKN (5071)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535863.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355822 TTGCACCTGATCGCAACAAAT pLKO_005 807 CDS 100% 13.200 18.480 N PRKN n/a
2 TRCN0000355823 ATGTATCTGTATGGGTCATTC pLKO_005 1869 3UTR 100% 10.800 15.120 N PRKN n/a
3 TRCN0000000282 CGCAACAAATAGTCGGAACAT pLKO.1 818 CDS 100% 4.950 6.930 N PRKN n/a
4 TRCN0000000283 CGTGATTTGCTTAGACTGTTT pLKO.1 902 CDS 100% 4.950 6.930 N PRKN n/a
5 TRCN0000000281 CGTGAACATAACTGAGGGCAT pLKO.1 2875 3UTR 100% 2.160 1.728 N PRKN n/a
6 TRCN0000000285 CTTAGACTGTTTCCACTTATA pLKO.1 911 CDS 100% 13.200 9.240 N PRKN n/a
7 TRCN0000355825 GACTCAATGATCGGCAGTTTG pLKO_005 943 CDS 100% 10.800 7.560 N PRKN n/a
8 TRCN0000355824 GGCCTACAGAGTCGATGAAAG pLKO_005 1298 CDS 100% 10.800 7.560 N PRKN n/a
9 TRCN0000041146 CGATTCTGACACCAGCATCTT pLKO.1 185 CDS 100% 4.950 3.465 N Park2 n/a
10 TRCN0000000284 CTCCAAAGAAACCATCAAGAA pLKO.1 1349 CDS 100% 4.950 3.465 N PRKN n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3733 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535863.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11015 pDONR223 100% 75.2% 74.7% None (many diffs) n/a
2 ccsbBroad304_11015 pLX_304 0% 75.2% 74.7% V5 (many diffs) n/a
3 TRCN0000467471 TCTTACTCACATTGAGATACATTG pLX_317 4.5% 75.2% 74.7% V5 (many diffs) n/a
Download CSV