Transcript: Human XM_011535887.2

PREDICTED: Homo sapiens ubiquitin conjugating enzyme E2 J1 (UBE2J1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBE2J1 (51465)
Length:
4477
CDS:
587..1423

Additional Resources:

NCBI RefSeq record:
XM_011535887.2
NBCI Gene record:
UBE2J1 (51465)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535887.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004134 CAGCTCTTATATTCCGACGAA pLKO.1 1362 CDS 100% 2.640 3.696 N UBE2J1 n/a
2 TRCN0000320500 CAGCTCTTATATTCCGACGAA pLKO_005 1362 CDS 100% 2.640 3.696 N UBE2J1 n/a
3 TRCN0000008439 GCTCTTATATTCCGACGAATA pLKO.1 1364 CDS 100% 1.080 1.512 N Ube2j1 n/a
4 TRCN0000321362 GCTCTTATATTCCGACGAATA pLKO_005 1364 CDS 100% 1.080 1.512 N Ube2j1 n/a
5 TRCN0000004130 CCACCAAGCATTATTCTCCTA pLKO.1 800 CDS 100% 2.640 2.112 N UBE2J1 n/a
6 TRCN0000320498 CCACCAAGCATTATTCTCCTA pLKO_005 800 CDS 100% 2.640 2.112 N UBE2J1 n/a
7 TRCN0000320501 ACATTCTGCATTGGGTATAAT pLKO_005 1468 3UTR 100% 15.000 10.500 N UBE2J1 n/a
8 TRCN0000368973 TCCGGCTGTTAAACGTTTAAT pLKO_005 613 CDS 100% 15.000 10.500 N UBE2J1 n/a
9 TRCN0000008440 CCATGAAACCACCAAGCATTA pLKO.1 792 CDS 100% 10.800 7.560 N Ube2j1 n/a
10 TRCN0000321361 CCATGAAACCACCAAGCATTA pLKO_005 792 CDS 100% 10.800 7.560 N Ube2j1 n/a
11 TRCN0000004133 CCAAGAGACAACCACACTGAT pLKO.1 1295 CDS 100% 4.950 3.465 N UBE2J1 n/a
12 TRCN0000004131 GCTGAGATTGTGTGCTAGGAA pLKO.1 3287 3UTR 100% 3.000 2.100 N UBE2J1 n/a
13 TRCN0000004132 CGTGGAGTATAAGGACAGCAT pLKO.1 900 CDS 100% 2.640 1.848 N UBE2J1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535887.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08296 pDONR223 100% 87.3% 87.1% None 557_558ins120;565C>G n/a
2 ccsbBroad304_08296 pLX_304 0% 87.3% 87.1% V5 557_558ins120;565C>G n/a
3 TRCN0000472566 AATGTGCACTTTTATTGAATTCAA pLX_317 40.2% 87.3% 87.1% V5 557_558ins120;565C>G n/a
Download CSV