Transcript: Human XM_011536062.3

PREDICTED: Homo sapiens PR/SET domain 1 (PRDM1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRDM1 (639)
Length:
6135
CDS:
1168..3687

Additional Resources:

NCBI RefSeq record:
XM_011536062.3
NBCI Gene record:
PRDM1 (639)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536062.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013611 CCCTACGGCATGAATTGTAAT pLKO.1 2458 CDS 100% 13.200 18.480 N PRDM1 n/a
2 TRCN0000013608 GCCCACAATCAACAGTGGTTT pLKO.1 5959 3UTR 100% 4.950 6.930 N PRDM1 n/a
3 TRCN0000013609 CGGGATGAACATCTACTTCTA pLKO.1 1743 CDS 100% 4.950 3.960 N PRDM1 n/a
4 TRCN0000218813 ACGAAGCCATGAATCTCATTA pLKO_005 2840 CDS 100% 13.200 9.240 N PRDM1 n/a
5 TRCN0000235671 CATCTACTTCTACACCATTAA pLKO_005 1752 CDS 100% 13.200 9.240 N PRDM1 n/a
6 TRCN0000235668 CCAACAGTGAAGAGGTTATTG pLKO_005 1487 CDS 100% 13.200 9.240 N PRDM1 n/a
7 TRCN0000235669 CCACTTCATTGACGGCTTTAA pLKO_005 1644 CDS 100% 13.200 9.240 N PRDM1 n/a
8 TRCN0000013610 CGAAGCCATGAATCTCATTAA pLKO.1 2841 CDS 100% 13.200 9.240 N PRDM1 n/a
9 TRCN0000235670 TCCCATTACTAAGACTATTAC pLKO_005 3994 3UTR 100% 13.200 9.240 N PRDM1 n/a
10 TRCN0000013612 GCCTGAAAGTGTCTTTGCAAA pLKO.1 3521 CDS 100% 4.950 3.465 N PRDM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536062.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00163 pDONR223 100% 82.2% 82% None (many diffs) n/a
2 ccsbBroad304_00163 pLX_304 32.4% 82.2% 82% V5 (many diffs) n/a
3 TRCN0000492300 CGTCGGGTCCTCGACTCTACATTA pLX_317 10.7% 82.2% 82% V5 (many diffs) n/a
Download CSV