Transcript: Human XM_011536189.3

PREDICTED: Homo sapiens failed axon connections homolog, metaxin like GST domain containing (FAXC), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAXC (84553)
Length:
929
CDS:
44..814

Additional Resources:

NCBI RefSeq record:
XM_011536189.3
NBCI Gene record:
FAXC (84553)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536189.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145210 GACTTACCGTATCAGAACTAT pLKO.1 431 CDS 100% 5.625 7.875 N FAXC n/a
2 TRCN0000193397 CAGTTTGCAAGACCTAACAAT pLKO.1 353 CDS 100% 5.625 3.938 N Faxc n/a
3 TRCN0000145447 GCAAGAGATTGACTCTAAAGA pLKO.1 316 CDS 100% 5.625 3.938 N FAXC n/a
4 TRCN0000139241 CGGAAGATGCTCTCTCTTAGT pLKO.1 897 3UTR 100% 4.950 3.465 N FAXC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536189.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09201 pDONR223 100% 56.4% 49.5% None (many diffs) n/a
2 ccsbBroad304_09201 pLX_304 0% 56.4% 49.5% V5 (many diffs) n/a
3 TRCN0000468524 AGGACATTGAAATAATTGTCCCCC pLX_317 38.1% 56.4% 49.5% V5 (many diffs) n/a
Download CSV