Construct: ORF TRCN0000468524
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003658.1_s317c1
- Derived from:
- ccsbBroadEn_09201
- DNA Barcode:
- AGGACATTGAAATAATTGTCCCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FAXC (84553)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468524
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84553 | FAXC | failed axon connections hom... | NM_032511.4 | 99.9% | 100% | 603A>G |
| 2 | human | 84553 | FAXC | failed axon connections hom... | NM_001346531.2 | 86.9% | 87% | 0_1ins159;444A>G |
| 3 | human | 84553 | FAXC | failed axon connections hom... | NM_001346532.1 | 86.9% | 87% | 0_1ins159;444A>G |
| 4 | human | 84553 | FAXC | failed axon connections hom... | NM_001346530.2 | 70.3% | 70.4% | 0_1ins363;240A>G |
| 5 | human | 84553 | FAXC | failed axon connections hom... | NM_001346533.1 | 70.3% | 70.4% | 0_1ins363;240A>G |
| 6 | human | 84553 | FAXC | failed axon connections hom... | XM_011536189.3 | 56.4% | 49.5% | (many diffs) |
| 7 | human | 84553 | FAXC | failed axon connections hom... | XM_006715582.2 | 47.1% | 47.1% | 0_1ins648 |
| 8 | human | 84553 | FAXC | failed axon connections hom... | NR_144464.1 | 8.3% | (many diffs) | |
| 9 | human | 84553 | FAXC | failed axon connections hom... | NR_144463.2 | 7.9% | (many diffs) | |
| 10 | mouse | 76132 | Faxc | failed axon connections hom... | NM_175234.4 | 93.4% | 98.5% | (many diffs) |
| 11 | mouse | 76132 | Faxc | failed axon connections hom... | XM_006538340.3 | 65% | 69.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1293
- ORF length:
- 1227
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca ctggggggtt ggctttgctt cgtccaggcc gtgcgtggtg gatctgagct 121 ggaaccagag catctccttc ttcggctggt gggccgggtc cgaggagccc ttctcctttt 181 atggggacat catcgctttc cctttgcagg attacggtgg gatcatggca gggctgggct 241 ccgatccctg gtggaagaaa accctttact tgaccggggg agctttgctg gccgcagctg 301 cgtatctgct ccacgaactc ctggtcatta ggaaacagca agagattgac tctaaagatg 361 ctattatttt gcatcagttt gcaagaccta acaatggtgt tccaagttta tctcctttct 421 gtttaaagat ggaaacttat ttaaggatgg ctgacttacc gtatcagaac tattttggtg 481 gaaaactctc tgctcaaggg aaaatgcctt ggattgaata taatcatgaa aaagtttctg 541 gcacagaatt cataattgac tttctggaag agaagcttgg agtgaattta aacaaaaacc 601 ttggccctca tgaaagagcc atctccagag cggtgaccaa gatggtggag gagcacttct 661 actggacgtt agcttattgc cagtgggtgg acaatctcaa tgagacccgg aagatgctct 721 ctcttagtgg tggtggtccc ttcagcaacc tgctgaggtg ggttgtgtgc cacataacga 781 aaggaattgt gaaacgcgag atgcacggcc acggcattgg ccgcttcTCC GAGGAAGAGA 841 TTTACATGCT GATGGAGAAG GACATGCGGT CTTTAGCAGG GCTTTTGGGT GATAAGAAGT 901 ACATCATGGG GCCCAAGCTT TCCACTCTTG ACGCCACTGT CTTTGGACAC TTGGCACAGG 961 CAATGTGGAC CTTACCAGGG ACAAGACCCG AACGGCTGAT CAAAGGTGAG CTGATCAACC 1021 TTGCCATGTA CTGTGAGAGG ATAAGGAGGA AATTTTGGCC AGAGTGGCAC CACGATGATG 1081 ACAATACCAT CTATGAGTCT GAGGAGAGCA GCGAAGGCAG CAAAACCCAC ACCCCGCTGC 1141 TGGATTTTAG CTTTTACTCA AGGACAGAGA CCTTTGAAGA TGAGGGAGCA GAAAACAGTT 1201 TTTCCAGAAC CCCAGACACA GATTTTACTG GACACTCACT CTTTGATTCG GATGTGGACA 1261 TGGATGACTA TACAGACCAC GAACAGTGCA AGTGCCCAAC TTTCTTGTAC AAAGTGGTTG 1321 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1381 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAAG 1441 GACATTGAAA TAATTGTCCC CCACGCGTTA AGTCgacaat caacctctgg attacaaaat 1501 ttgtgaaaga tt