Transcript: Human XM_011536190.2

PREDICTED: Homo sapiens fibronectin type III domain containing 1 (FNDC1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FNDC1 (84624)
Length:
6474
CDS:
193..5808

Additional Resources:

NCBI RefSeq record:
XM_011536190.2
NBCI Gene record:
FNDC1 (84624)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536190.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436737 CCGAAGGGAAGGCGTAGATAA pLKO_005 1899 CDS 100% 13.200 18.480 N FNDC1 n/a
2 TRCN0000431864 GACTGCCATGGACGGCAATAT pLKO_005 5461 CDS 100% 13.200 18.480 N FNDC1 n/a
3 TRCN0000117930 CCTACTATTCAAGGCTACTAT pLKO.1 5680 CDS 100% 5.625 7.875 N FNDC1 n/a
4 TRCN0000117928 GCCCTAACAAAGCGAAAGATT pLKO.1 865 CDS 100% 5.625 3.938 N FNDC1 n/a
5 TRCN0000117929 CCTCCAAGATTCACATGGAAA pLKO.1 4239 CDS 100% 4.950 3.465 N FNDC1 n/a
6 TRCN0000117931 CGGAGACATACTCCTTCCTTA pLKO.1 464 CDS 100% 4.950 3.465 N FNDC1 n/a
7 TRCN0000117927 GCCTGGACAATGAACAGGATT pLKO.1 5986 3UTR 100% 4.950 3.465 N FNDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536190.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12834 pDONR223 100% 92.1% 92% None (many diffs) n/a
2 ccsbBroad304_12834 pLX_304 0% 92.1% 92% V5 (many diffs) n/a
3 TRCN0000479449 GCCCCTGTTACTTCTATGTGCCCT pLX_317 4.5% 92.1% 92% V5 (many diffs) n/a
Download CSV