Transcript: Human XM_011536385.3

PREDICTED: Homo sapiens WD repeat domain 89 (WDR89), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WDR89 (112840)
Length:
3105
CDS:
202..1365

Additional Resources:

NCBI RefSeq record:
XM_011536385.3
NBCI Gene record:
WDR89 (112840)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536385.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245574 GCGGACTACATAAGCGTTAAA pLKO_005 2406 3UTR 100% 13.200 18.480 N WDR89 n/a
2 TRCN0000167085 CGAGTACGAGTTCATAGTAAT pLKO.1 1315 CDS 100% 13.200 10.560 N WDR89 n/a
3 TRCN0000245576 CGAGTACGAGTTCATAGTAAT pLKO_005 1315 CDS 100% 13.200 10.560 N WDR89 n/a
4 TRCN0000245575 TGGTCTGGGAAAGGTTATAAA pLKO_005 871 CDS 100% 15.000 10.500 N WDR89 n/a
5 TRCN0000245577 CTACGAGAATTTAGTGGATAT pLKO_005 388 CDS 100% 10.800 7.560 N WDR89 n/a
6 TRCN0000245573 GAAGATGCTTTGGACTATTTG pLKO_005 1012 CDS 100% 13.200 7.920 N WDR89 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536385.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10475 pDONR223 100% 99.9% 99.7% None 1159C>T n/a
2 ccsbBroad304_10475 pLX_304 0% 99.9% 99.7% V5 (not translated due to prior stop codon) 1159C>T n/a
3 TRCN0000472320 CGCGGCCCGTGAAAGATAAAAATG pLX_317 8.8% 99.9% 99.7% V5 (not translated due to prior stop codon) 1159C>T n/a
Download CSV