Transcript: Human XM_011536422.2

PREDICTED: Homo sapiens kelch domain containing 1 (KLHDC1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLHDC1 (122773)
Length:
2191
CDS:
14..1078

Additional Resources:

NCBI RefSeq record:
XM_011536422.2
NBCI Gene record:
KLHDC1 (122773)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536422.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143098 CTTGGATACAGGTCACTGTAA pLKO.1 985 CDS 100% 0.495 0.693 N KLHDC1 n/a
2 TRCN0000176830 GATACAGGTCACTGTAATGAT pLKO.1 989 CDS 100% 0.563 0.450 N Klhdc1 n/a
3 TRCN0000176579 CTACGTGTCTATTGAAGACAA pLKO.1 103 CDS 100% 0.495 0.347 N Klhdc1 n/a
4 TRCN0000144643 GAGGATATGATGACAAAGGAT pLKO.1 267 CDS 100% 3.000 1.800 N KLHDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536422.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09473 pDONR223 100% 85.5% 25.4% None (many diffs) n/a
2 ccsbBroad304_09473 pLX_304 0% 85.5% 25.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476132 GGGACGTCCTCTAATCATGACTCG pLX_317 19.9% 85.5% 25.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV