Transcript: Human XM_011536475.2

PREDICTED: Homo sapiens FAM161 centrosomal protein B (FAM161B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM161B (145483)
Length:
2599
CDS:
77..2197

Additional Resources:

NCBI RefSeq record:
XM_011536475.2
NBCI Gene record:
FAM161B (145483)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536475.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130487 GAAGTCTCAAGCAATGTCCAA pLKO.1 1729 CDS 100% 2.640 3.696 N FAM161B n/a
2 TRCN0000130742 GAACCGGAACAATGACCGTAA pLKO.1 1825 CDS 100% 4.050 3.240 N FAM161B n/a
3 TRCN0000370168 TGACTCAACTGGGAGCATTTA pLKO_005 448 CDS 100% 13.200 9.240 N FAM161B n/a
4 TRCN0000365115 ACAACCTTCCCTCCAACATTC pLKO_005 672 CDS 100% 10.800 7.560 N FAM161B n/a
5 TRCN0000365116 AGGAAATGAAGCAGCGAATAC pLKO_005 1875 CDS 100% 10.800 7.560 N FAM161B n/a
6 TRCN0000365117 CCTATCGCCTCCTCTAGTAAC pLKO_005 1259 CDS 100% 10.800 7.560 N FAM161B n/a
7 TRCN0000370167 GCTCCTGGGCATCATCCATTA pLKO_005 753 CDS 100% 10.800 7.560 N FAM161B n/a
8 TRCN0000130905 GCCAAGGATCTAGCCAAGAAA pLKO.1 1925 CDS 100% 5.625 3.938 N FAM161B n/a
9 TRCN0000128789 CCAGGTTCCAAGAAACTACAA pLKO.1 2067 CDS 100% 4.950 3.465 N FAM161B n/a
10 TRCN0000215992 CTATCTCTTTGAACAAGTTAC pLKO.1 1906 CDS 100% 10.800 7.560 N Fam161b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536475.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09622 pDONR223 100% 89.2% 88.6% None (many diffs) n/a
2 ccsbBroad304_09622 pLX_304 0% 89.2% 88.6% V5 (many diffs) n/a
3 TRCN0000479313 CCTCCTGATATCTTGTGGACACAT pLX_317 23.3% 89.2% 88.6% V5 (many diffs) n/a
Download CSV