Transcript: Human XM_011536515.3

PREDICTED: Homo sapiens spectrin repeat containing nuclear envelope family member 3 (SYNE3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SYNE3 (161176)
Length:
7705
CDS:
124..3075

Additional Resources:

NCBI RefSeq record:
XM_011536515.3
NBCI Gene record:
SYNE3 (161176)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536515.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281603 CATCGTCGACGCGCAAATCTT pLKO_005 2512 CDS 100% 5.625 7.875 N SYNE3 n/a
2 TRCN0000282854 AGCCTGGGAGCAGCAGATTAA pLKO_005 1140 CDS 100% 13.200 9.240 N SYNE3 n/a
3 TRCN0000179208 GCAGGACATTGCCAAAGATTT pLKO.1 933 CDS 100% 13.200 9.240 N SYNE3 n/a
4 TRCN0000263891 ATCAATCCCATGGATCCTATT pLKO_005 2485 CDS 100% 10.800 7.560 N SYNE3 n/a
5 TRCN0000263890 CAGAAGGTCAGCATCTCTTTG pLKO_005 2705 CDS 100% 10.800 7.560 N SYNE3 n/a
6 TRCN0000180861 GCTGTACAAGTCCAAGCTGAA pLKO.1 2796 CDS 100% 4.050 2.835 N SYNE3 n/a
7 TRCN0000178965 CGCAAATCTTCTACAGGAAGA pLKO.1 2523 CDS 100% 0.405 0.284 N SYNE3 n/a
8 TRCN0000282853 CTGCAGAGCTGCATCCATATC pLKO_005 3180 3UTR 100% 10.800 6.480 N SYNE3 n/a
9 TRCN0000264485 TGCTGCACAACGTGGACAATC pLKO_005 623 CDS 100% 10.800 6.480 N Syne3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536515.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000476789 AGCCACTTGTTGCCACTCCAACCA pLX_317 .8% 98.8% 98.7% V5 (many diffs) n/a
Download CSV