Transcript: Human XM_011536853.1

PREDICTED: Homo sapiens transmembrane protein 260 (TMEM260), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM260 (54916)
Length:
4434
CDS:
761..2416

Additional Resources:

NCBI RefSeq record:
XM_011536853.1
NBCI Gene record:
TMEM260 (54916)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536853.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263785 ATGACTTACGAGTGGTATTTA pLKO_005 1694 CDS 100% 15.000 21.000 N TMEM260 n/a
2 TRCN0000263782 TAAGTCATCTCCCAGATATAA pLKO_005 2518 3UTR 100% 15.000 21.000 N TMEM260 n/a
3 TRCN0000263783 GACCAACTATGTGATTGATAA pLKO_005 1534 CDS 100% 13.200 18.480 N TMEM260 n/a
4 TRCN0000147950 GTAACAAATATGAGGACCGAA pLKO.1 1157 CDS 100% 2.640 3.696 N TMEM260 n/a
5 TRCN0000263781 TATGCCTCATGATGCAATTAT pLKO_005 1579 CDS 100% 15.000 10.500 N TMEM260 n/a
6 TRCN0000263784 CTATAACTGGACCGAAGAATA pLKO_005 1990 CDS 100% 13.200 9.240 N TMEM260 n/a
7 TRCN0000175898 GCCAAGAACTTTCACTGACTT pLKO.1 4210 3UTR 100% 4.950 3.465 N Tmem260 n/a
8 TRCN0000148428 CCCTTGCAGTTTGTGCAAATA pLKO.1 1197 CDS 100% 1.320 0.924 N TMEM260 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536853.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12110 pDONR223 100% 35.7% 35.6% None 0_1ins468;759_1653delinsA n/a
2 ccsbBroad304_12110 pLX_304 0% 35.7% 35.6% V5 0_1ins468;759_1653delinsA n/a
3 TRCN0000474223 CACTTGCGCGCGGGTTTTGTCGCG pLX_317 42.7% 35.7% 35.6% V5 0_1ins468;759_1653delinsA n/a
Download CSV