Transcript: Human XM_011537053.3

PREDICTED: Homo sapiens MOK protein kinase (MOK), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MOK (5891)
Length:
2044
CDS:
690..1442

Additional Resources:

NCBI RefSeq record:
XM_011537053.3
NBCI Gene record:
MOK (5891)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537053.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001715 ACCTCTACTAACAACCAATTT pLKO.1 977 CDS 100% 13.200 18.480 N MOK n/a
2 TRCN0000001716 CTGGGCTAATATACTTGTAAA pLKO.1 1774 3UTR 100% 13.200 9.240 N MOK n/a
3 TRCN0000199597 GTGGTCAGACTGTCGTCTTAC pLKO.1 1305 CDS 100% 10.800 7.560 N MOK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537053.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491430 TCATCCCTGACAGACCTTTTAGAT pLX_317 25.1% 51.8% 43.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487807 GCAGCCTTTTTAGATATATGGCCC pLX_317 24.9% 51.7% 43.3% V5 (many diffs) n/a
Download CSV