Transcript: Human XM_011537063.3

PREDICTED: Homo sapiens reticulon 1 (RTN1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RTN1 (6252)
Length:
4593
CDS:
659..2521

Additional Resources:

NCBI RefSeq record:
XM_011537063.3
NBCI Gene record:
RTN1 (6252)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537063.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183306 GCAAAGGGATTATCGTATGAA pLKO.1 1745 CDS 100% 5.625 7.875 N RTN1 n/a
2 TRCN0000183412 CGTGGCTTATTTAGTTCTGAT pLKO.1 1133 CDS 100% 4.950 6.930 N RTN1 n/a
3 TRCN0000432929 GACACTGACATCTCAATTAAA pLKO_005 1334 CDS 100% 15.000 10.500 N RTN1 n/a
4 TRCN0000146278 CGTGTTACACATCTCTCATTT pLKO.1 966 CDS 100% 13.200 9.240 N RTN1 n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3988 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3988 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537063.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11113 pDONR223 100% 68.9% 65.1% None (many diffs) n/a
2 ccsbBroad304_11113 pLX_304 0% 68.9% 65.1% V5 (many diffs) n/a
Download CSV