Transcript: Human XM_011537106.1

PREDICTED: Homo sapiens signal recognition particle 54 (SRP54), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRP54 (6729)
Length:
2162
CDS:
233..1747

Additional Resources:

NCBI RefSeq record:
XM_011537106.1
NBCI Gene record:
SRP54 (6729)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537106.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147836 GCTAATGCTATACAACCTGAT pLKO.1 857 CDS 100% 4.050 5.670 N SRP54 n/a
2 TRCN0000278301 GCTAATGCTATACAACCTGAT pLKO_005 857 CDS 100% 4.050 5.670 N SRP54 n/a
3 TRCN0000147124 CGAGACATGTATGAGCAATTT pLKO.1 1220 CDS 100% 13.200 10.560 N SRP54 n/a
4 TRCN0000278303 CGAGACATGTATGAGCAATTT pLKO_005 1220 CDS 100% 13.200 10.560 N SRP54 n/a
5 TRCN0000150065 CTTCTGAAGGAGTAGAGAAAT pLKO.1 747 CDS 100% 13.200 9.240 N SRP54 n/a
6 TRCN0000278368 CTTCTGAAGGAGTAGAGAAAT pLKO_005 747 CDS 100% 13.200 9.240 N SRP54 n/a
7 TRCN0000102451 CCATTATCAATGAAGAGGTAT pLKO.1 294 CDS 100% 4.950 3.465 N Srp54a n/a
8 TRCN0000146835 CTTGCTTATCATGCACTCTTT pLKO.1 1847 3UTR 100% 4.950 3.465 N SRP54 n/a
9 TRCN0000278302 CTTGCTTATCATGCACTCTTT pLKO_005 1847 3UTR 100% 4.950 3.465 N SRP54 n/a
10 TRCN0000102452 GCATATTATTACCAGAGGAAA pLKO.1 596 CDS 100% 4.950 3.465 N Srp54a n/a
11 TRCN0000147307 GCTTCAAGTTGCTAATGCTAT pLKO.1 847 CDS 100% 4.950 3.465 N SRP54 n/a
12 TRCN0000150054 CCTTCTTTCCTCCCTTTAATA pLKO.1 1911 3UTR 100% 15.000 9.000 N SRP54 n/a
13 TRCN0000278369 CCTTCTTTCCTCCCTTTAATA pLKO_005 1911 3UTR 100% 15.000 9.000 N SRP54 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537106.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15599 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15599 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468672 ACCATTACCCTAGGTCTATTGGAA pLX_317 30.5% 99.9% 98.6% V5 (not translated due to frame shift) 1497delG n/a
4 ccsbBroadEn_13960 pDONR223 100% 99.6% 98.8% None (many diffs) n/a
5 ccsbBroad304_13960 pLX_304 0% 99.6% 98.8% V5 (not translated due to frame shift) (many diffs) n/a
6 TRCN0000465542 TCAATGTTTCTCCGGTTCTGATCG pLX_317 24.1% 99.6% 98.8% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV