Transcript: Human XM_011537362.2

PREDICTED: Homo sapiens mitogen-activated protein kinase 1 interacting protein 1 like (MAPK1IP1L), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAPK1IP1L (93487)
Length:
6663
CDS:
970..1746

Additional Resources:

NCBI RefSeq record:
XM_011537362.2
NBCI Gene record:
MAPK1IP1L (93487)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537362.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161511 GCCATATCCTACACCAAATAT pLKO.1 1350 CDS 100% 15.000 21.000 N MAPK1IP1L n/a
2 TRCN0000330293 GCCATATCCTACACCAAATAT pLKO_005 1350 CDS 100% 15.000 21.000 N MAPK1IP1L n/a
3 TRCN0000353656 TCGAGAATAACCCATCATAAT pLKO_005 2158 3UTR 100% 13.200 10.560 N MAPK1IP1L n/a
4 TRCN0000165703 CCAACCCTTGGAATAATCCGA pLKO.1 1118 CDS 100% 0.750 0.600 N MAPK1IP1L n/a
5 TRCN0000159179 GCAACTTCATTGGCAAATTAT pLKO.1 2090 3UTR 100% 15.000 10.500 N MAPK1IP1L n/a
6 TRCN0000166260 CCTCTGCTGTGAGCAATACAA pLKO.1 1064 CDS 100% 5.625 3.938 N MAPK1IP1L n/a
7 TRCN0000330223 CCTCTGCTGTGAGCAATACAA pLKO_005 1064 CDS 100% 5.625 3.938 N MAPK1IP1L n/a
8 TRCN0000165829 GCAGTGTGACTGTGTTGCTTA pLKO.1 3053 3UTR 100% 4.950 3.465 N MAPK1IP1L n/a
9 TRCN0000165556 GACTCTATCCTACTCCCAGTA pLKO.1 1655 CDS 100% 4.050 2.835 N MAPK1IP1L n/a
10 TRCN0000330294 GACTCTATCCTACTCCCAGTA pLKO_005 1655 CDS 100% 4.050 2.835 N MAPK1IP1L n/a
11 TRCN0000166261 CCTTGGAATAATCCGAGTGCT pLKO.1 1123 CDS 100% 2.640 1.848 N MAPK1IP1L n/a
12 TRCN0000163537 GTAATCCTTTCCAAGTGCCTT pLKO.1 1673 CDS 100% 2.640 1.848 N MAPK1IP1L n/a
13 TRCN0000165138 GATCCATGTCTTCTGGACCTT pLKO.1 1445 CDS 100% 2.640 1.584 N MAPK1IP1L n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4280 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 127 5UTR 100% 2.640 1.320 Y LINC01098 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4280 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537362.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09358 pDONR223 100% 94.8% 94.9% None 1_39del;582A>G n/a
2 ccsbBroad304_09358 pLX_304 0% 94.8% 94.9% V5 1_39del;582A>G n/a
3 TRCN0000474167 AGCCGCACTACAATACTCTCAATT pLX_317 66.7% 94.8% 94.9% V5 1_39del;582A>G n/a
Download CSV