Transcript: Human XM_011537589.3

PREDICTED: Homo sapiens solute carrier family 36 member 1 (SLC36A1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC36A1 (206358)
Length:
6601
CDS:
1046..2476

Additional Resources:

NCBI RefSeq record:
XM_011537589.3
NBCI Gene record:
SLC36A1 (206358)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537589.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218737 ACTAATGTTCACCTCGTATTT pLKO_005 5786 3UTR 100% 13.200 18.480 N SLC36A1 n/a
2 TRCN0000229646 ACAACAATGAGACGGTGATTC pLKO_005 1587 CDS 100% 10.800 8.640 N SLC36A1 n/a
3 TRCN0000008700 CCTTTGTGGATTATGGTGATA pLKO.1 1380 CDS 100% 4.950 3.960 N SLC36A1 n/a
4 TRCN0000008701 CCTGCAATTTGGAGCTAATAT pLKO.1 1978 CDS 100% 15.000 10.500 N SLC36A1 n/a
5 TRCN0000229647 CCTGCAATTTGGAGCTAATAT pLKO_005 1978 CDS 100% 15.000 10.500 N SLC36A1 n/a
6 TRCN0000229644 AGACCTTGATCCACCTGTTAA pLKO_005 1197 CDS 100% 13.200 9.240 N SLC36A1 n/a
7 TRCN0000229645 GCATGGGTATCCTGGTGAAAT pLKO_005 1326 CDS 100% 13.200 9.240 N SLC36A1 n/a
8 TRCN0000008702 CAGACCTTGATCCACCTGTTA pLKO.1 1196 CDS 100% 4.950 3.465 N SLC36A1 n/a
9 TRCN0000008699 GCCGCTATCTTAGCTGTCTTT pLKO.1 4557 3UTR 100% 4.950 3.465 N SLC36A1 n/a
10 TRCN0000008703 CCAGTTCATTGTTCAGAGGAT pLKO.1 1753 CDS 100% 2.640 1.848 N SLC36A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537589.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.