Transcript: Human XM_011537652.1

PREDICTED: Homo sapiens phosphodiesterase 6A (PDE6A), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDE6A (5145)
Length:
3839
CDS:
267..1772

Additional Resources:

NCBI RefSeq record:
XM_011537652.1
NBCI Gene record:
PDE6A (5145)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537652.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418249 GACACGGAAGGAAATCGTTAT pLKO_005 1304 CDS 100% 10.800 7.560 N PDE6A n/a
2 TRCN0000008604 CGTGGATCAGTCTAAGACATA pLKO.1 1241 CDS 100% 4.950 3.465 N PDE6A n/a
3 TRCN0000008602 CTTGAGAAGTAGAAGAGTCAT pLKO.1 1852 3UTR 100% 4.950 3.465 N PDE6A n/a
4 TRCN0000011456 CCGATTGTGAACAAGAAGGAA pLKO.1 354 CDS 100% 3.000 2.100 N PDE6A n/a
5 TRCN0000011455 GCCATCCACATGATGGACATT pLKO.1 1161 CDS 100% 0.495 0.347 N PDE6A n/a
6 TRCN0000073413 CGCCTGTAATTCCAGCACTTT pLKO.1 3562 3UTR 100% 4.950 2.475 Y LILRB1 n/a
7 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2493 3UTR 100% 4.950 2.475 Y ERN2 n/a
8 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2493 3UTR 100% 4.950 2.475 Y P3H4 n/a
9 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2493 3UTR 100% 4.950 2.475 Y P3H4 n/a
10 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2495 3UTR 100% 4.950 2.475 Y CFLAR n/a
11 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2495 3UTR 100% 4.950 2.475 Y C19orf31 n/a
12 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 3729 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537652.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.