Transcript: Human XM_011537673.2

PREDICTED: Homo sapiens potassium channel tetramerization domain containing 16 (KCTD16), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCTD16 (57528)
Length:
3629
CDS:
1021..1881

Additional Resources:

NCBI RefSeq record:
XM_011537673.2
NBCI Gene record:
KCTD16 (57528)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537673.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069800 GTTCCGTTATATTCTGGACTA pLKO.1 1263 CDS 100% 4.050 5.670 N Kctd16 n/a
2 TRCN0000128551 GTTCCGTTATATTCTGGACTA pLKO.1 1263 CDS 100% 4.050 5.670 N KCTD16 n/a
3 TRCN0000129305 CACGGCTAATGATCTAGCCAA pLKO.1 1200 CDS 100% 0.264 0.370 N KCTD16 n/a
4 TRCN0000129573 CCAAGGAAGCGACACAAGAAT pLKO.1 1449 CDS 100% 5.625 3.938 N KCTD16 n/a
5 TRCN0000069799 CAGAAAGATACACCTCCAGAT pLKO.1 1676 CDS 100% 4.050 2.835 N Kctd16 n/a
6 TRCN0000129601 CTGCCTGATCACTTTCCAGAA pLKO.1 1306 CDS 100% 4.050 2.835 N KCTD16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537673.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03827 pDONR223 100% 66.1% 64.7% None (many diffs) n/a
2 ccsbBroad304_03827 pLX_304 0% 66.1% 64.7% V5 (many diffs) n/a
3 TRCN0000476014 TTGCCGCTCATATGCTACTTAATG pLX_317 28% 66.1% 64.7% V5 (many diffs) n/a
Download CSV