Transcript: Human XM_011537951.3

PREDICTED: Homo sapiens copine 8 (CPNE8), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPNE8 (144402)
Length:
4301
CDS:
58..1254

Additional Resources:

NCBI RefSeq record:
XM_011537951.3
NBCI Gene record:
CPNE8 (144402)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537951.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145295 GCAGTCACAATTCAACGTATA pLKO.1 831 CDS 100% 10.800 15.120 N CPNE8 n/a
2 TRCN0000141687 CCAACTGAATGCCTATGGTAT pLKO.1 1062 CDS 100% 4.950 6.930 N CPNE8 n/a
3 TRCN0000433592 GATCCAATTTGTGTCTTATAT pLKO_005 190 CDS 100% 15.000 10.500 N CPNE8 n/a
4 TRCN0000424629 CATTAAGGGAGGGACGCAAAT pLKO_005 960 CDS 100% 10.800 7.560 N CPNE8 n/a
5 TRCN0000141026 CAGGGAAGAAATGTGGTACAA pLKO.1 473 CDS 100% 4.950 3.465 N CPNE8 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 3914 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537951.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09610 pDONR223 100% 69.4% 67.9% None (many diffs) n/a
2 ccsbBroad304_09610 pLX_304 0% 69.4% 67.9% V5 (many diffs) n/a
3 TRCN0000470434 CTCCCATCACTATCATTTATGTTA pLX_317 27.4% 69.4% 67.9% V5 (many diffs) n/a
Download CSV