Transcript: Human XM_011538207.2

PREDICTED: Homo sapiens adhesion G protein-coupled receptor D1 (ADGRD1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ADGRD1 (283383)
Length:
6534
CDS:
560..2983

Additional Resources:

NCBI RefSeq record:
XM_011538207.2
NBCI Gene record:
ADGRD1 (283383)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358406 CCAACGTCAACCTCGTGATAG pLKO_005 1266 CDS 100% 10.800 15.120 N ADGRD1 n/a
2 TRCN0000358404 GCAAGCACCGTTACTACTATG pLKO_005 2664 CDS 100% 10.800 15.120 N ADGRD1 n/a
3 TRCN0000358322 TGAGTCTCATCGACACTATTG pLKO_005 1698 CDS 100% 10.800 15.120 N ADGRD1 n/a
4 TRCN0000014413 GCACCGTTACTACTATGGGAT pLKO.1 2668 CDS 100% 2.640 3.696 N ADGRD1 n/a
5 TRCN0000014415 CGACACTATTGACACCGTCAT pLKO.1 1708 CDS 100% 4.050 3.240 N ADGRD1 n/a
6 TRCN0000358403 GTTACGGAACAAGCAACAATT pLKO_005 2745 CDS 100% 13.200 9.240 N ADGRD1 n/a
7 TRCN0000358402 TGTCGGGCTCTCCACTCATTA pLKO_005 2085 CDS 100% 13.200 9.240 N ADGRD1 n/a
8 TRCN0000358407 GCACTCACCTCACCAACTTTG pLKO_005 2277 CDS 100% 10.800 7.560 N ADGRD1 n/a
9 TRCN0000358318 TGCCTACCATCCCATCATAAC pLKO_005 1477 CDS 100% 10.800 7.560 N ADGRD1 n/a
10 TRCN0000014414 CCAGGCCAAGTGTTATGAGAA pLKO.1 1300 CDS 100% 4.950 3.465 N ADGRD1 n/a
11 TRCN0000014417 CCTGTTTGTCATCGTGGTCAA pLKO.1 2815 CDS 100% 4.050 2.835 N ADGRD1 n/a
12 TRCN0000014416 CCTATTTACATGGAAATCCAA pLKO.1 1165 CDS 100% 3.000 2.100 N ADGRD1 n/a
13 TRCN0000358408 ATTGGACTCATGTCCTATTTA pLKO_005 1152 CDS 100% 15.000 9.000 N ADGRD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538207.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16146 pDONR223 0% 83.8% 83.4% None (many diffs) n/a
2 ccsbBroad304_16146 pLX_304 0% 83.8% 83.4% V5 (many diffs) n/a
3 TRCN0000479828 TTAATTCGAGAGTACCCGGTTCGT pLX_317 13.4% 83.8% 90% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV