Transcript: Human XM_011538249.2

PREDICTED: Homo sapiens histidine ammonia-lyase (HAL), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HAL (3034)
Length:
2746
CDS:
55..1176

Additional Resources:

NCBI RefSeq record:
XM_011538249.2
NBCI Gene record:
HAL (3034)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538249.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078282 GCATCCATGAACTTGCTGCAA pLKO.1 578 CDS 100% 2.640 3.696 N HAL n/a
2 TRCN0000427373 GGTGTGGTGAATGATACAATA pLKO_005 415 CDS 100% 13.200 10.560 N HAL n/a
3 TRCN0000222705 CCCTCAAACAAGTCATAGAAA pLKO.1 28 5UTR 100% 5.625 4.500 N HAL n/a
4 TRCN0000078278 GCCTTAATATGCCTTCATAAA pLKO.1 1649 3UTR 100% 13.200 9.240 N HAL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538249.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06350 pDONR223 100% 56.7% 56.4% None 0_1ins844;3_4insCTAAATAC;463G>A n/a
2 ccsbBroad304_06350 pLX_304 0% 56.7% 56.4% V5 0_1ins844;3_4insCTAAATAC;463G>A n/a
3 TRCN0000471830 AGGAGCATCGCCCTTGGGTCGAAA pLX_317 25% 56.7% 56.4% V5 0_1ins844;3_4insCTAAATAC;463G>A n/a
Download CSV