Transcript: Human XM_011538423.1

PREDICTED: Homo sapiens WASH complex subunit 3 (WASHC3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WASHC3 (51019)
Length:
675
CDS:
81..590

Additional Resources:

NCBI RefSeq record:
XM_011538423.1
NBCI Gene record:
WASHC3 (51019)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538423.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000330169 GTGTACCAGTGATGGCAATAA pLKO_005 517 CDS 100% 13.200 9.240 N WASHC3 n/a
2 TRCN0000134348 GACTACAGGAAAGTGAAGTAT pLKO.1 427 CDS 100% 5.625 3.938 N WASHC3 n/a
3 TRCN0000330097 GACTACAGGAAAGTGAAGTAT pLKO_005 427 CDS 100% 5.625 3.938 N WASHC3 n/a
4 TRCN0000133819 CTAGATGATGTCACAGTTGAA pLKO.1 315 CDS 100% 4.950 3.465 N WASHC3 n/a
5 TRCN0000134605 GATGATGTCACAGTTGAAGTA pLKO.1 318 CDS 100% 4.950 3.465 N WASHC3 n/a
6 TRCN0000330167 GATGATGTCACAGTTGAAGTA pLKO_005 318 CDS 100% 4.950 3.465 N WASHC3 n/a
7 TRCN0000330098 GATCCAAGATATGCCAGATAT pLKO_005 477 CDS 100% 13.200 7.920 N WASHC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538423.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08195 pDONR223 100% 85.6% 85.5% None 329A>G;502_505delGTGA;507_508ins79 n/a
2 ccsbBroad304_08195 pLX_304 0% 85.6% 85.5% V5 329A>G;502_505delGTGA;507_508ins79 n/a
3 TRCN0000473745 GAATACGAATTTGGGGTATACTTA pLX_317 93.5% 85.6% 85.5% V5 329A>G;502_505delGTGA;507_508ins79 n/a
Download CSV