Transcript: Human XM_011538483.1

PREDICTED: Homo sapiens histone deacetylase 7 (HDAC7), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HDAC7 (51564)
Length:
2122
CDS:
16..1836

Additional Resources:

NCBI RefSeq record:
XM_011538483.1
NBCI Gene record:
HDAC7 (51564)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538483.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255690 AGAAGCTAGCGGAGGTGATTC pLKO_005 524 CDS 100% 10.800 15.120 N HDAC7 n/a
2 TRCN0000381512 CAACCTGAAGCTGCGCTATAA pLKO_005 735 CDS 100% 13.200 9.240 N HDAC7 n/a
3 TRCN0000255689 CCACTTTGCCCAGTCCTTAAT pLKO_005 1260 CDS 100% 13.200 9.240 N HDAC7 n/a
4 TRCN0000199823 GCTGCGCTATAAGCCCAAGAA pLKO.1 744 CDS 100% 4.950 3.465 N HDAC7 n/a
5 TRCN0000004846 GCCCTAGAAAGAACAGTCCAT pLKO.1 562 CDS 100% 2.640 1.848 N HDAC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538483.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488732 ACCAGACGAACGCTCAGACTTCCC pLX_317 10.9% 50.5% 50% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV