Construct: ORF TRCN0000488732
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF021957.1_s317c1
- DNA Barcode:
- ACCAGACGAACGCTCAGACTTCCC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- HDAC7 (51564)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000488732
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 51564 | HDAC7 | histone deacetylase 7 | NM_001098416.4 | 100% | 100% | |
2 | human | 51564 | HDAC7 | histone deacetylase 7 | NM_015401.5 | 96.2% | 96.2% | 795_905del |
3 | human | 51564 | HDAC7 | histone deacetylase 7 | XM_011538480.1 | 95.4% | 95% | (many diffs) |
4 | human | 51564 | HDAC7 | histone deacetylase 7 | XM_024449018.1 | 95.2% | 95% | (many diffs) |
5 | human | 51564 | HDAC7 | histone deacetylase 7 | NM_001368046.1 | 94.9% | 94.9% | 460_501del;837_947del |
6 | human | 51564 | HDAC7 | histone deacetylase 7 | NM_001308090.2 | 94.5% | 94.5% | 18_19ins51;744_854del |
7 | human | 51564 | HDAC7 | histone deacetylase 7 | XM_017019455.1 | 93.1% | 91.8% | (many diffs) |
8 | human | 51564 | HDAC7 | histone deacetylase 7 | XM_011538481.1 | 92.3% | 92.3% | 0_1ins117;678_788del |
9 | human | 51564 | HDAC7 | histone deacetylase 7 | XM_011538482.1 | 92.3% | 92.3% | 0_1ins117;678_788del |
10 | human | 51564 | HDAC7 | histone deacetylase 7 | XM_011538478.1 | 92% | 91.6% | (many diffs) |
11 | human | 51564 | HDAC7 | histone deacetylase 7 | XR_001748761.1 | 63.4% | (many diffs) | |
12 | human | 51564 | HDAC7 | histone deacetylase 7 | NR_160435.1 | 58.8% | (many diffs) | |
13 | human | 51564 | HDAC7 | histone deacetylase 7 | XM_017019456.1 | 58.7% | 58.2% | (many diffs) |
14 | human | 51564 | HDAC7 | histone deacetylase 7 | NR_160436.1 | 58.6% | (many diffs) | |
15 | human | 51564 | HDAC7 | histone deacetylase 7 | XM_011538483.1 | 50.5% | 50% | (many diffs) |
16 | mouse | 56233 | Hdac7 | histone deacetylase 7 | NM_019572.3 | 84.1% | 87% | (many diffs) |
17 | mouse | 56233 | Hdac7 | histone deacetylase 7 | XM_011245699.1 | 82.6% | 85.8% | (many diffs) |
18 | mouse | 56233 | Hdac7 | histone deacetylase 7 | NM_001204278.1 | 82% | 85.2% | (many diffs) |
19 | mouse | 56233 | Hdac7 | histone deacetylase 7 | XM_006521203.2 | 80.9% | 83.7% | (many diffs) |
20 | mouse | 56233 | Hdac7 | histone deacetylase 7 | NM_001204279.1 | 80% | 83% | (many diffs) |
21 | mouse | 56233 | Hdac7 | histone deacetylase 7 | NM_001204276.1 | 79.5% | 82.6% | (many diffs) |
22 | mouse | 56233 | Hdac7 | histone deacetylase 7 | NM_001204277.1 | 79.5% | 82.2% | (many diffs) |
23 | mouse | 56233 | Hdac7 | histone deacetylase 7 | NM_001204275.1 | 79% | 82% | (many diffs) |
24 | mouse | 56233 | Hdac7 | histone deacetylase 7 | XM_006521205.2 | 79% | 82% | (many diffs) |
25 | mouse | 56233 | Hdac7 | histone deacetylase 7 | XM_006521207.3 | 79% | 82% | (many diffs) |
26 | mouse | 56233 | Hdac7 | histone deacetylase 7 | XM_006521208.3 | 79% | 82% | (many diffs) |
27 | mouse | 56233 | Hdac7 | histone deacetylase 7 | XM_006521209.2 | 79% | 82% | (many diffs) |
28 | mouse | 56233 | Hdac7 | histone deacetylase 7 | XM_006521210.2 | 79% | 82% | (many diffs) |
29 | mouse | 56233 | Hdac7 | histone deacetylase 7 | NM_001204281.1 | 77.8% | 81.2% | (many diffs) |
30 | mouse | 56233 | Hdac7 | histone deacetylase 7 | NM_001204280.1 | 77.5% | 80.4% | (many diffs) |
31 | mouse | 56233 | Hdac7 | histone deacetylase 7 | XR_875306.1 | 71.2% | (many diffs) | |
32 | mouse | 56233 | Hdac7 | histone deacetylase 7 | XR_875307.2 | 55.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2931
- ORF length:
- 2862
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcaccat gcacagcccc ggcgctgatg ggacccaggt gagcccgggt gcccactact 121 gcagccccac tggcgcaggc tgccccaggc cctgtgcaga cacaccaggc cctcagccgc 181 agcccatgga cctgcgggtg ggccagcggc ccccagtgga gcccccacca gagcccacat 241 tgctggccct gcagcgtccc cagcgcctgc accaccacct cttcctagca ggcctgcagc 301 agcagcgctc ggtggagccc atgaggctct ccatggacac gccgatgccc gagttgcagg 361 tgggacccca ggaacaagag ctgcggcagc ttctccacaa ggacaagagc aagcgaagtg 421 ctgtagccag cagcgtggtc aagcagaagc tagcggaggt gattctgaaa aaacagcagg 481 cggccctaga aagaacagtc catcccaaca gccccggcat tccctacaga accctggagc 541 ccctggagac ggaaggagcc acccgctcca tgctcagcag ctttttgcct cctgttccca 601 gcctgcccag tgacccccca gagcacttcc ctctgcgcaa gacagtctct gagcccaacc 661 tgaagctgcg ctataagccc aagaagtccc tggagcggag gaagaatcca ctgctccgaa 721 aggagagtgc gccccccagc ctccggcggc ggcccgcaga gaccctcgga gactcctccc 781 caagtagtag cagcacgccc gcatcagggt gcagctcccc caatgacagc gagcacggcc 841 ccaatcccat cctgggctcg gaggctgaca gtgaccgcag gacccatccg actctgggcc 901 ctcgggggcc aatcctgggg agcccccaca ctcccctctt cctgccccat ggcttggagc 961 ccgaggctgg gggcaccttg ccctctcgcc tgcagcccat tctcctcctg gacccctcag 1021 gctctcatgc cccgctgctg actgtgcccg ggcttgggcc cttgcccttc cactttgccc 1081 agtccttaat gaccaccgag cggctctctg ggtcaggcct ccactggcca ctgagccgga 1141 ctcgctcaga gcccctgccc cccagtgcca ccgctccccc accgccgggc cccatgcagc 1201 cccgcctgga gcagctcaaa actcacgtcc aggtgatcaa gaggtcagcc aagccgagtg 1261 agaagccccg gctgcggcag ataccctcgg ctgaagacct ggagacagat ggcgggggac 1321 cgggccaggt ggtggacgat ggcctggagc acagggagct gggccatggg cagcctgagg 1381 ccagaggccc cgctcctctc cagcagcacc ctcaggtgtt gctctgggaa cagcagcgac 1441 tggctgggcg gctcccccgg ggcagcaccg gggacactgt gctgcttcct ctggcccagg 1501 gtgggcaccg gcctctgtcc cgggctcagt cttccccagc cgcacctgcc tcactgtcag 1561 ccccagagcc tgccagccag gcccgagtcc tctccagctc agagacccct gccaggaccc 1621 tgcccttcac cacagggctg atctatgact cggtcatgct gaagcaccag tgctcctgcg 1681 gtgacaacag caggcacccg gagcacgccg gccgcatcca gagcatctgg tcccggctgc 1741 aggagcgggg gctccggagc cagtgtgagt gtctccgagg ccggaaggcc tccctggaag 1801 agctgcagtc ggtccactct gagcggcacg tgctcctcta cggcaccaac ccgctcagcc 1861 gcctcaaact ggacaacggg aagctggcag ggctcctggc acagcggatg tttgtgatgc 1921 tgccctgtgg tggggttggg gtggacactg acaccatctg gaatgagctt cattcctcca 1981 atgcagcccg ctgggccgct ggcagtgtca ctgacctcgc cttcaaagtg gcttctcgtg 2041 agctaaagaa tggtttcgct gtggtgcggc ccccaggaca ccatgcagat cattcaacag 2101 ccatgggctt ctgcttcttc aactcagtgg ccatcgcctg ccggcagctg caacagcaga 2161 gcaaggccag caagatcctc attgtagact gggacgtgca ccatggcaac ggcacccagc 2221 aaaccttcta ccaagacccc agtgtgctct acatctccct gcatcgccat gacgacggca 2281 acttcttccc ggggagtggg gctgtggatg aggtaggggc tggcagcggt gagggcttca 2341 atgtcaatgt ggcctgggct ggaggtctgg acccccccat gggggatcct gagtacctgg 2401 ctgctttcag gatagtcgtg atgcccatcg cccgagagtt ctctccagac ctagtcctgg 2461 tgtctgctgg atttgatgct gctgagggtc acccggcccc actgggtggc taccatgttt 2521 ctgccaaatg ttttggatac atgacgcagc aactgatgaa cctggcagga ggcgcagtgg 2581 tgctggcctt ggagggtggc catgacctca cagccatctg tgacgccTCT GAGGCCTGTG 2641 TGGCTGCTCT TCTGGGTAAC AGGGTGGATC CCCTTTCAGA AGAAGGCTGG AAACAGAAAC 2701 CCAACCTCAA TGCCATCCGC TCTCTGGAGG CCGTGATCCG GGTGCACAGT AAATACTGGG 2761 GCTGCATGCA GCGCCTGGCC TCCTGTCCAG ACTCCTGGGT GCCTAGAGTG CCAGGGGCTG 2821 ACAAAGAAGA AGTGGAGGCA GTGACCGCAC TGGCGTCCCT CTCTGTGGGC ATCCTGGCTG 2881 AAGATAGGCC CTCGGAGCAG CTGGTGGAGG AGGAAGAACC TATGAATCTC TAAGACCCAG 2941 CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC TAACCCTCTC CTCGGTCTCG 3001 ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT TTCGATTTCT TGGCTTTATA 3061 TATCTTGTGG AAAGGACGAA CCAGACGAAC GCTCAGACTT CCCACGCGTT AAGTCgacaa 3121 tcaacctctg gattacaaaa tttgtgaaag att