Transcript: Human XM_011538681.3

PREDICTED: Homo sapiens TBC1 domain family member 15 (TBC1D15), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBC1D15 (64786)
Length:
1461
CDS:
24..1394

Additional Resources:

NCBI RefSeq record:
XM_011538681.3
NBCI Gene record:
TBC1D15 (64786)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538681.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231962 ATGACCAAGACGGCTTGATTT pLKO_005 106 CDS 100% 13.200 18.480 N TBC1D15 n/a
2 TRCN0000231963 GCATTAGATTCCTCTAGTATT pLKO_005 192 CDS 100% 13.200 18.480 N TBC1D15 n/a
3 TRCN0000155572 CCTGTTCAGTTTGACAGACCT pLKO.1 407 CDS 100% 2.640 2.112 N TBC1D15 n/a
4 TRCN0000231964 GGGTATGGGCTGGTCCTATTT pLKO_005 452 CDS 100% 13.200 9.240 N TBC1D15 n/a
5 TRCN0000152174 CCAAGTCATAGAAATGGGAAA pLKO.1 372 CDS 100% 4.050 2.835 N TBC1D15 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1421 3UTR 100% 13.200 6.600 Y LIAS n/a
7 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 1420 3UTR 100% 4.950 2.475 Y ERAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538681.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12494 pDONR223 100% 65.6% 65.1% None (many diffs) n/a
2 ccsbBroad304_12494 pLX_304 0% 65.6% 65.1% V5 (many diffs) n/a
Download CSV