Transcript: Human XM_011538766.3

PREDICTED: Homo sapiens centrosomal protein 290 (CEP290), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEP290 (80184)
Length:
7052
CDS:
111..6881

Additional Resources:

NCBI RefSeq record:
XM_011538766.3
NBCI Gene record:
CEP290 (80184)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538766.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276333 ATCTCGGAAAGAGGCTATAAA pLKO_005 1595 CDS 100% 15.000 21.000 N CEP290 n/a
2 TRCN0000145444 GAAGAACGACTTGATCTGAAA pLKO.1 210 CDS 100% 4.950 3.960 N CEP290 n/a
3 TRCN0000285535 GAAGAACGACTTGATCTGAAA pLKO_005 210 CDS 100% 4.950 3.960 N CEP290 n/a
4 TRCN0000285536 GAACTAGAACTGGCTAATAAA pLKO_005 2313 CDS 100% 15.000 10.500 N CEP290 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538766.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14281 pDONR223 100% 7.2% 7.1% None (many diffs) n/a
2 ccsbBroad304_14281 pLX_304 0% 7.2% 7.1% V5 (many diffs) n/a
3 TRCN0000473474 TTGTATCTCTTCCGAGTCCTCCGT pLX_317 71.2% 7.2% 7.1% V5 (many diffs) n/a
Download CSV