Transcript: Human XM_011538793.3

PREDICTED: Homo sapiens glycosyltransferase 8 domain containing 2 (GLT8D2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GLT8D2 (83468)
Length:
2211
CDS:
1017..2066

Additional Resources:

NCBI RefSeq record:
XM_011538793.3
NBCI Gene record:
GLT8D2 (83468)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538793.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034920 CCTCTGAACTTTGTTCGATTT pLKO.1 1416 CDS 100% 10.800 8.640 N GLT8D2 n/a
2 TRCN0000034923 CGGAATACTCTGACTCGAATA pLKO.1 1278 CDS 100% 10.800 8.640 N GLT8D2 n/a
3 TRCN0000034921 GCCAACATCTTGTTCTATGTA pLKO.1 1248 CDS 100% 5.625 3.938 N GLT8D2 n/a
4 TRCN0000034919 CCCTGTATAGAAATGTGGAAT pLKO.1 2090 3UTR 100% 4.950 3.465 N GLT8D2 n/a
5 TRCN0000034922 GCAGGGATATTTAAACTCAAT pLKO.1 2034 CDS 100% 4.950 3.465 N GLT8D2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538793.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04272 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04272 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481036 CGCGCTGGTGCACCGTAGACTGGC pLX_317 39.4% 100% 100% V5 n/a
Download CSV