Transcript: Human XM_011539279.1

PREDICTED: Homo sapiens pancreatic lipase related protein 3 (PNLIPRP3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PNLIPRP3 (119548)
Length:
2187
CDS:
295..1383

Additional Resources:

NCBI RefSeq record:
XM_011539279.1
NBCI Gene record:
PNLIPRP3 (119548)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539279.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150090 CAACTATCCAAGCCTCATATT pLKO.1 206 5UTR 100% 13.200 18.480 N PNLIPRP3 n/a
2 TRCN0000148969 GCTGTAAACAATCTCCGTGTT pLKO.1 376 CDS 100% 4.050 3.240 N PNLIPRP3 n/a
3 TRCN0000148685 CCATGCCCGAAGTTATCAATT pLKO.1 813 CDS 100% 13.200 9.240 N PNLIPRP3 n/a
4 TRCN0000448132 GCCAACTTTGTTGACGTTATT pLKO_005 610 CDS 100% 13.200 9.240 N PNLIPRP3 n/a
5 TRCN0000183548 GCTTATCTGTTATGTGTTCAT pLKO.1 1967 3UTR 100% 4.950 3.465 N PNLIPRP3 n/a
6 TRCN0000148778 CAGAATAAGTTGGGAGCAGAA pLKO.1 1264 CDS 100% 4.050 2.835 N PNLIPRP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539279.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09462 pDONR223 100% 77.3% 77% None 0_1ins315;826G>A;829A>G n/a
2 ccsbBroad304_09462 pLX_304 0% 77.3% 77% V5 0_1ins315;826G>A;829A>G n/a
3 TRCN0000465744 CAGGGTCGTTTCACTCCGCTAAAC pLX_317 24.5% 77.3% 77% V5 0_1ins315;826G>A;829A>G n/a
Download CSV