Transcript: Human XM_011539649.1

PREDICTED: Homo sapiens R3H domain and coiled-coil containing 1 like (R3HCC1L), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
R3HCC1L (27291)
Length:
3683
CDS:
587..2944

Additional Resources:

NCBI RefSeq record:
XM_011539649.1
NBCI Gene record:
R3HCC1L (27291)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539649.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255879 CGGAGGCTCGAAGACTAAATA pLKO_005 804 CDS 100% 15.000 21.000 N R3HCC1L n/a
2 TRCN0000135199 CGTGATGCGTTGGGTATTAAA pLKO.1 2642 CDS 100% 15.000 21.000 N R3HCC1L n/a
3 TRCN0000255881 TGATCAAACTTGCGTAGATTT pLKO_005 1438 CDS 100% 13.200 18.480 N R3HCC1L n/a
4 TRCN0000255883 AGCTGATGAGACCTCTATTAA pLKO_005 1810 CDS 100% 15.000 12.000 N R3HCC1L n/a
5 TRCN0000255880 TACAGGAGATGTGGGTATTTA pLKO_005 3485 3UTR 100% 15.000 10.500 N R3HCC1L n/a
6 TRCN0000255882 TGCTTCCTCCTTACCTATAAA pLKO_005 2014 CDS 100% 15.000 10.500 N R3HCC1L n/a
7 TRCN0000135181 CCTAACTCTGTGGTGAAAGAA pLKO.1 734 CDS 100% 5.625 3.938 N R3HCC1L n/a
8 TRCN0000135878 GAATGGACACATGCCTTCAAA pLKO.1 885 CDS 100% 5.625 3.938 N R3HCC1L n/a
9 TRCN0000136511 CCAGATGGTGTCTTTGATCAA pLKO.1 1424 CDS 100% 4.950 3.465 N R3HCC1L n/a
10 TRCN0000137949 GCAAGATGACTCAGGGAGTAT pLKO.1 2203 CDS 100% 4.950 3.465 N R3HCC1L n/a
11 TRCN0000138571 CATGGTGAAGATTCGTCCCTT pLKO.1 2668 CDS 100% 2.640 1.848 N R3HCC1L n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 150 5UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 150 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539649.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11861 pDONR223 100% 23.3% 23.1% None 1_1804del;1805_1806insT;1946A>G n/a
2 ccsbBroad304_11861 pLX_304 0% 23.3% 23.1% V5 1_1804del;1805_1806insT;1946A>G n/a
3 TRCN0000465466 TGGTAGACTAATACCTAGCTCCGG pLX_317 62.2% 23.3% 23.1% V5 1_1804del;1805_1806insT;1946A>G n/a
Download CSV