Transcript: Human XM_011539751.3

PREDICTED: Homo sapiens lipase family member M (LIPM), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LIPM (340654)
Length:
6321
CDS:
3892..4800

Additional Resources:

NCBI RefSeq record:
XM_011539751.3
NBCI Gene record:
LIPM (340654)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539751.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000050718 GAACATGAATACTCATGGTTT pLKO.1 4359 CDS 100% 0.495 0.396 N LIPM n/a
2 TRCN0000050719 CCAAGATGAGTTCTGGGCTTT pLKO.1 3948 CDS 100% 4.050 2.835 N LIPM n/a
3 TRCN0000050721 CCAGGTGATTCTTGATCAGAT pLKO.1 4290 CDS 100% 4.950 2.970 N LIPM n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539751.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14478 pDONR223 100% 75.5% 75.3% None 0_1ins264;474_494del;520C>A n/a
2 ccsbBroad304_14478 pLX_304 0% 75.5% 75.3% V5 0_1ins264;474_494del;520C>A n/a
3 TRCN0000475665 GCGTGAGCAACATAATTGGTACAT pLX_317 23.2% 75.5% 75.3% V5 0_1ins264;474_494del;520C>A n/a
Download CSV