Transcript: Human XM_011539769.3

PREDICTED: Homo sapiens NHL repeat containing 2 (NHLRC2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NHLRC2 (374354)
Length:
2181
CDS:
240..2171

Additional Resources:

NCBI RefSeq record:
XM_011539769.3
NBCI Gene record:
NHLRC2 (374354)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539769.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303767 AGTTACTGATAGATTGGTAAT pLKO_005 938 CDS 100% 10.800 15.120 N NHLRC2 n/a
2 TRCN0000064215 CCTATGGTTAATGATGCAGAT pLKO.1 669 CDS 100% 4.050 5.670 N NHLRC2 n/a
3 TRCN0000064217 GCCACCTTCACCATTGCTATT pLKO.1 893 CDS 100% 10.800 8.640 N NHLRC2 n/a
4 TRCN0000064213 CGGCTAAGTTTCCAAATGAAA pLKO.1 598 CDS 100% 5.625 4.500 N NHLRC2 n/a
5 TRCN0000217826 CTTCACCTACTGCTGCATAAA pLKO.1 494 CDS 100% 13.200 9.240 N Nhlrc2 n/a
6 TRCN0000310768 TCCACAGGGTGTAGCCATAAT pLKO_005 1079 CDS 100% 13.200 9.240 N NHLRC2 n/a
7 TRCN0000310766 TGAACACAGAAGAACCTATTT pLKO_005 430 CDS 100% 13.200 9.240 N NHLRC2 n/a
8 TRCN0000303766 ATGTTGCAGACTCCTACAATC pLKO_005 1708 CDS 100% 10.800 7.560 N NHLRC2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539769.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13625 pDONR223 100% 38.9% 38.9% None 1_1077del;1925_1926delTAinsGC;1929_1929delCins250 n/a
2 ccsbBroad304_13625 pLX_304 0% 38.9% 38.9% V5 1_1077del;1925_1926delTAinsGC;1929_1929delCins250 n/a
3 TRCN0000472285 ACACGACGCCCATAGGCCCGACGT pLX_317 52.6% 38.9% 38.9% V5 1_1077del;1925_1926delTAinsGC;1929_1929delCins250 n/a
Download CSV