Transcript: Human XM_011539854.2

PREDICTED: Homo sapiens dual specificity phosphatase 13 (DUSP13), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DUSP13 (51207)
Length:
1319
CDS:
479..1075

Additional Resources:

NCBI RefSeq record:
XM_011539854.2
NBCI Gene record:
DUSP13 (51207)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539854.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421401 TGGACACAGGTGCCAAATTCT pLKO_005 732 CDS 100% 5.625 7.875 N DUSP13 n/a
2 TRCN0000414504 CCGCAATATCTGCCCTAACTC pLKO_005 991 CDS 100% 4.950 6.930 N DUSP13 n/a
3 TRCN0000003063 GTTCAGTCCATCTCTATAATA pLKO.1 1276 3UTR 100% 15.000 12.000 N DUSP13 n/a
4 TRCN0000003065 TGAGAACATGACGCTGGTAGA pLKO.1 946 CDS 100% 4.050 3.240 N DUSP13 n/a
5 TRCN0000003064 TGCCACACTGAACCATATCGA pLKO.1 598 CDS 100% 3.000 2.400 N DUSP13 n/a
6 TRCN0000422534 GAATCACCCACGTTGTGAATG pLKO_005 690 CDS 100% 10.800 7.560 N DUSP13 n/a
7 TRCN0000417385 GAATGTCCCTGGAGTACTATG pLKO_005 759 CDS 100% 10.800 7.560 N DUSP13 n/a
8 TRCN0000431692 TCTAGTGACCCTGAGATGTAA pLKO_005 1153 3UTR 100% 5.625 3.938 N DUSP13 n/a
9 TRCN0000003062 CTTTCTGCCTGTTGCTCGATA pLKO.1 823 CDS 100% 4.950 3.465 N DUSP13 n/a
10 TRCN0000431515 TCCTGGCCTTCCTCATGATCT pLKO_005 924 CDS 100% 4.950 3.465 N DUSP13 n/a
11 TRCN0000003061 GTCTACTTTCTGCCTGTTGCT pLKO.1 818 CDS 100% 2.640 1.848 N DUSP13 n/a
12 TRCN0000416424 AGCTCCAGGTTCTGGACAACC pLKO_005 1026 CDS 100% 1.350 0.945 N DUSP13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539854.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08254 pDONR223 100% 99.4% 98.9% None 13C>G;315C>T;467G>A n/a
2 ccsbBroad304_08254 pLX_304 0% 99.4% 98.9% V5 13C>G;315C>T;467G>A n/a
3 TRCN0000469415 TGTTGGAGTTATTTGGACCTATGA pLX_317 80.7% 99.4% 98.9% V5 13C>G;315C>T;467G>A n/a
Download CSV