Transcript: Human XM_011539871.3

PREDICTED: Homo sapiens coiled-coil serine rich protein 2 (CCSER2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCSER2 (54462)
Length:
4184
CDS:
297..2552

Additional Resources:

NCBI RefSeq record:
XM_011539871.3
NBCI Gene record:
CCSER2 (54462)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539871.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430752 CTTCATATTCTTCGATCAATA pLKO_005 778 CDS 100% 13.200 9.240 N CCSER2 n/a
2 TRCN0000429814 AGAACCAACAGCTATCCATTA pLKO_005 1060 CDS 100% 10.800 7.560 N CCSER2 n/a
3 TRCN0000432774 TAATAGAGCTGTGGATCTTAC pLKO_005 1028 CDS 100% 10.800 7.560 N CCSER2 n/a
4 TRCN0000062106 CCCAGGTGTAACTTCTACTTT pLKO.1 1214 CDS 100% 5.625 3.938 N CCSER2 n/a
5 TRCN0000062107 CCAGAGGAAATGTCTCTCAAA pLKO.1 1587 CDS 100% 4.950 3.465 N CCSER2 n/a
6 TRCN0000062105 GCATGATATTCAACTGTCATT pLKO.1 2381 CDS 100% 4.950 3.465 N CCSER2 n/a
7 TRCN0000062104 GCTCAGAAGATGTTTGTTGAT pLKO.1 2232 CDS 100% 4.950 3.465 N CCSER2 n/a
8 TRCN0000062103 GCTGCTAATAAGGACCAAGAA pLKO.1 1374 CDS 100% 4.950 3.465 N CCSER2 n/a
9 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3976 3UTR 100% 4.950 2.475 Y ORAI2 n/a
10 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 3973 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539871.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12042 pDONR223 100% 69.5% 67.4% None (many diffs) n/a
2 ccsbBroad304_12042 pLX_304 0% 69.5% 67.4% V5 (many diffs) n/a
Download CSV