Transcript: Human XM_011539960.2

PREDICTED: Homo sapiens tudor domain containing 1 (TDRD1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TDRD1 (56165)
Length:
4818
CDS:
97..3666

Additional Resources:

NCBI RefSeq record:
XM_011539960.2
NBCI Gene record:
TDRD1 (56165)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539960.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161346 GCAGGAGTAAAGCCATCATTA pLKO.1 1924 CDS 100% 13.200 18.480 N TDRD1 n/a
2 TRCN0000164048 CCACCCTAATTTCAGGCTGAA pLKO.1 243 CDS 100% 4.050 5.670 N TDRD1 n/a
3 TRCN0000240912 TAGGGACTTTCTGCTATATAT pLKO_005 3904 3UTR 100% 15.000 12.000 N TDRD1 n/a
4 TRCN0000240913 ACTTCTACGTGCAGTTATATT pLKO_005 929 CDS 100% 15.000 10.500 N TDRD1 n/a
5 TRCN0000240910 ATGTTCACTTGAAGGATTAAT pLKO_005 3258 CDS 100% 15.000 10.500 N TDRD1 n/a
6 TRCN0000240911 ATTGCCAATGCAAGCTATAAA pLKO_005 1893 CDS 100% 15.000 10.500 N TDRD1 n/a
7 TRCN0000240909 ATGAGACTTTGTCCCATAATC pLKO_005 1858 CDS 100% 13.200 9.240 N TDRD1 n/a
8 TRCN0000158923 CCACTTGTTATCCCAGAATAA pLKO.1 2726 CDS 100% 13.200 9.240 N TDRD1 n/a
9 TRCN0000160552 CCACATAAAGACTTACCAAAT pLKO.1 2794 CDS 100% 10.800 7.560 N TDRD1 n/a
10 TRCN0000160623 CCTTTGCTTTCATGTTTGTTA pLKO.1 4195 3UTR 100% 5.625 3.938 N TDRD1 n/a
11 TRCN0000158433 CCACATAATGTCCTTTGCTTT pLKO.1 4184 3UTR 100% 4.950 3.465 N TDRD1 n/a
12 TRCN0000162375 CCTCATGTCAGTGTTAGCAAA pLKO.1 2071 CDS 100% 4.950 3.465 N TDRD1 n/a
13 TRCN0000189725 GCTCAGTTCTCAGAGGATGAT pLKO.1 1744 CDS 100% 4.950 3.465 N Tdrd1 n/a
14 TRCN0000160922 GCAAGGAATACATAGGGACTT pLKO.1 3892 3UTR 100% 4.050 2.835 N TDRD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539960.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.