Transcript: Human XM_011540215.2

PREDICTED: Homo sapiens tankyrase 2 (TNKS2), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNKS2 (80351)
Length:
6307
CDS:
1936..4023

Additional Resources:

NCBI RefSeq record:
XM_011540215.2
NBCI Gene record:
TNKS2 (80351)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540215.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053239 GCTGCCAAGAAGGGTTGTTTA pLKO.1 2476 CDS 100% 13.200 18.480 N TNKS2 n/a
2 TRCN0000424214 CATTTAGCAGCTGGTTATAAT pLKO_005 2572 CDS 100% 15.000 10.500 N TNKS2 n/a
3 TRCN0000423546 TGAGCACCTAATGGATATATT pLKO_005 3183 CDS 100% 15.000 10.500 N TNKS2 n/a
4 TRCN0000424818 AGGGTATCTCATTAGGTAATT pLKO_005 1970 CDS 100% 13.200 9.240 N TNKS2 n/a
5 TRCN0000423098 GTGTCAATGCCACGGACAAAT pLKO_005 2732 CDS 100% 13.200 9.240 N TNKS2 n/a
6 TRCN0000053242 GCCAGCAGTCTTGACAACTTA pLKO.1 3034 CDS 100% 5.625 3.938 N TNKS2 n/a
7 TRCN0000053241 GCAGTAGTTAATGTAGCTGAT pLKO.1 2269 CDS 100% 4.050 2.835 N TNKS2 n/a
8 TRCN0000053240 CCAGTGTAAATGGCCTAGCAT pLKO.1 3908 CDS 100% 3.000 2.100 N TNKS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540215.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488738 AATGCTGACTGTTTTCTGTTTCAG pLX_317 11.8% 59.5% 59.6% V5 (not translated due to prior stop codon) 0_1ins1413;948G>A n/a
Download CSV