Transcript: Human XM_011540219.3

PREDICTED: Homo sapiens tetraspanin 14 (TSPAN14), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TSPAN14 (81619)
Length:
4206
CDS:
256..1110

Additional Resources:

NCBI RefSeq record:
XM_011540219.3
NBCI Gene record:
TSPAN14 (81619)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540219.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000382426 ATGAGTCCATCTTCACGAAAG pLKO_005 935 CDS 100% 6.000 8.400 N TSPAN14 n/a
2 TRCN0000155210 GATGAGTCCATCTTCACGAAA pLKO.1 934 CDS 100% 4.950 6.930 N TSPAN14 n/a
3 TRCN0000382437 ACCTCAACGTCTACTTCAATT pLKO_005 785 CDS 100% 13.200 9.240 N TSPAN14 n/a
4 TRCN0000380341 GTGAACACACAGTGTGGATAT pLKO_005 883 CDS 100% 10.800 7.560 N TSPAN14 n/a
5 TRCN0000382359 AGTGACCCGGATGCATGGAAT pLKO_005 453 CDS 100% 4.950 3.465 N TSPAN14 n/a
6 TRCN0000158318 CCTCTCTTTCTCCTCCACATA pLKO.1 2045 3UTR 100% 4.950 3.465 N TSPAN14 n/a
7 TRCN0000151115 GCTCTTGGAAATGAAGTCTTA pLKO.1 2455 3UTR 100% 4.950 3.465 N TSPAN14 n/a
8 TRCN0000318942 GCTCTTGGAAATGAAGTCTTA pLKO_005 2455 3UTR 100% 4.950 3.465 N TSPAN14 n/a
9 TRCN0000156964 GCTGGTACAAGTACCTCCTTT pLKO.1 293 CDS 100% 4.950 3.465 N TSPAN14 n/a
10 TRCN0000318874 GCTGGTACAAGTACCTCCTTT pLKO_005 293 CDS 100% 4.950 3.465 N TSPAN14 n/a
11 TRCN0000158032 CGAGAGCAACATCAAGTCCTA pLKO.1 678 CDS 100% 2.640 1.848 N TSPAN14 n/a
12 TRCN0000349652 CGAGAGCAACATCAAGTCCTA pLKO_005 678 CDS 100% 2.640 1.848 N TSPAN14 n/a
13 TRCN0000154752 GCAGATATTTGGCATCTTCCT pLKO.1 1035 CDS 100% 2.640 1.848 N TSPAN14 n/a
14 TRCN0000154349 CCTCTGGTCTTGATAGCATTA pLKO.1 1795 3UTR 100% 10.800 6.480 N TSPAN14 n/a
15 TRCN0000318941 CCTCTGGTCTTGATAGCATTA pLKO_005 1795 3UTR 100% 10.800 6.480 N TSPAN14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540219.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12726 pDONR223 100% 89% 89% None 81_173del n/a
2 TRCN0000473275 GATGACACGCCCCAAGTCGGGAAG pLX_317 72% 89% 89% V5 81_173del n/a
Download CSV