Transcript: Human XM_011540239.2

PREDICTED: Homo sapiens solute carrier family 25 member 28 (SLC25A28), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC25A28 (81894)
Length:
1437
CDS:
286..1110

Additional Resources:

NCBI RefSeq record:
XM_011540239.2
NBCI Gene record:
SLC25A28 (81894)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236528 AGTGCCTTCAGGACGGTATAT pLKO_005 943 CDS 100% 13.200 18.480 N SLC25A28 n/a
2 TRCN0000043923 GCAGATGTACAACTCACCATA pLKO.1 609 CDS 100% 4.950 6.930 N SLC25A28 n/a
3 TRCN0000043925 CGCATGGTCTGTGTATGAGTT pLKO.1 1038 CDS 100% 4.950 3.960 N SLC25A28 n/a
4 TRCN0000236529 AGGCCCTCTGGAGGATTATAA pLKO_005 362 CDS 100% 15.000 10.500 N SLC25A28 n/a
5 TRCN0000236531 GGTGCAGGCCAGAGTAATTTA pLKO_005 996 CDS 100% 15.000 10.500 N SLC25A28 n/a
6 TRCN0000043927 CTTGGCTTTGAACTCACACAT pLKO.1 897 CDS 100% 4.950 3.465 N SLC25A28 n/a
7 TRCN0000043924 GCTGACCATGAACGTTCCTTT pLKO.1 708 CDS 100% 4.950 3.465 N SLC25A28 n/a
8 TRCN0000043926 CTCACACATTACAGGACATAT pLKO.1 909 CDS 100% 13.200 7.920 N SLC25A28 n/a
9 TRCN0000236530 CTGTGTATGAGTTCTTCAAAT pLKO_005 1046 CDS 100% 13.200 7.920 N SLC25A28 n/a
10 TRCN0000236527 TGCTGCATCCTGGTCACATTC pLKO_005 1147 3UTR 100% 10.800 6.480 N SLC25A28 n/a
11 TRCN0000069611 GCAGAGGATGCAGATGTACAA pLKO.1 600 CDS 100% 4.950 2.970 N Slc25a28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.