Transcript: Human XM_011540488.3

PREDICTED: Homo sapiens ubiquitination factor E4B (UBE4B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBE4B (10277)
Length:
5149
CDS:
160..3873

Additional Resources:

NCBI RefSeq record:
XM_011540488.3
NBCI Gene record:
UBE4B (10277)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540488.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007546 CCGATATAACACTGCCTTTAA pLKO.1 2552 CDS 100% 13.200 18.480 N UBE4B n/a
2 TRCN0000338295 GCCTAGTTGCCGTCGCTATAT pLKO_005 2274 CDS 100% 13.200 18.480 N UBE4B n/a
3 TRCN0000007549 CGCTATCATATTAGCACCATT pLKO.1 2941 CDS 100% 4.950 6.930 N UBE4B n/a
4 TRCN0000338354 GAAGTGTTCAAGCAGATATTT pLKO_005 1504 CDS 100% 15.000 10.500 N UBE4B n/a
5 TRCN0000338294 TGGACCAACTGACGGATATTT pLKO_005 3419 CDS 100% 15.000 10.500 N UBE4B n/a
6 TRCN0000007548 GCAGGGATCAAATCCACAATA pLKO.1 3541 CDS 100% 13.200 9.240 N UBE4B n/a
7 TRCN0000350907 GCAGGGATCAAATCCACAATA pLKO_005 3541 CDS 100% 13.200 9.240 N UBE4B n/a
8 TRCN0000338296 TAATCCAATATCCGTTGATTT pLKO_005 4222 3UTR 100% 13.200 9.240 N UBE4B n/a
9 TRCN0000007545 CCCTACTTAACATACTTGAAT pLKO.1 4954 3UTR 100% 5.625 3.938 N UBE4B n/a
10 TRCN0000092696 GAAGATGAAGAAGAAGATGAT pLKO.1 1069 CDS 100% 4.950 2.475 Y Hmgb1-ps7 n/a
11 TRCN0000093079 GATGAAGAAGAAGATGATGAT pLKO.1 1072 CDS 100% 4.950 2.475 Y Gm5518 n/a
12 TRCN0000063714 GAAGAAGATGATGATGATGAT pLKO.1 1078 CDS 100% 4.950 2.475 Y SET n/a
13 TRCN0000288612 GAAGAAGATGATGATGATGAT pLKO_005 1078 CDS 100% 4.950 2.475 Y SET n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540488.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.