Transcript: Human XM_011540495.2

PREDICTED: Homo sapiens tryptophanyl tRNA synthetase 2, mitochondrial (WARS2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WARS2 (10352)
Length:
2577
CDS:
58..882

Additional Resources:

NCBI RefSeq record:
XM_011540495.2
NBCI Gene record:
WARS2 (10352)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540495.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045578 CCTCGATTACAACATTTACAT pLKO.1 199 CDS 100% 5.625 7.875 N WARS2 n/a
2 TRCN0000311705 CCTCGATTACAACATTTACAT pLKO_005 199 CDS 100% 5.625 7.875 N WARS2 n/a
3 TRCN0000045581 CGAGTCCATTCTCACATCCAT pLKO.1 420 CDS 100% 3.000 2.400 N WARS2 n/a
4 TRCN0000311629 CGAGTCCATTCTCACATCCAT pLKO_005 420 CDS 100% 3.000 2.400 N WARS2 n/a
5 TRCN0000045580 CAGAGGAGATAGTGCAGAAAT pLKO.1 530 CDS 100% 13.200 9.240 N WARS2 n/a
6 TRCN0000311630 CAGAGGAGATAGTGCAGAAAT pLKO_005 530 CDS 100% 13.200 9.240 N WARS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540495.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07590 pDONR223 100% 76.1% 76.1% None 87_88ins258 n/a
2 ccsbBroad304_07590 pLX_304 0% 76.1% 76.1% V5 87_88ins258 n/a
3 TRCN0000466879 CTTATAACGTTATGAAACTCGTCA pLX_317 39.3% 76.1% 76.1% V5 87_88ins258 n/a
Download CSV