Transcript: Human XM_011540496.2

PREDICTED: Homo sapiens choline/ethanolamine phosphotransferase 1 (CEPT1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CEPT1 (10390)
Length:
2195
CDS:
156..1406

Additional Resources:

NCBI RefSeq record:
XM_011540496.2
NBCI Gene record:
CEPT1 (10390)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000353698 TGGTAACACGCCCTAACTATC pLKO_005 1538 3UTR 100% 10.800 15.120 N CEPT1 n/a
2 TRCN0000035970 CGCACTGGCAAACGTATGTTT pLKO.1 742 CDS 100% 5.625 7.875 N CEPT1 n/a
3 TRCN0000035971 GAGCCCTTAATGCAAGGGTAT pLKO.1 348 CDS 100% 0.405 0.567 N CEPT1 n/a
4 TRCN0000330737 ACTGTAGCAGGGACCATATTT pLKO_005 915 CDS 100% 15.000 10.500 N CEPT1 n/a
5 TRCN0000330814 CATCATTGGACTGTCAATAAA pLKO_005 422 CDS 100% 15.000 10.500 N CEPT1 n/a
6 TRCN0000330816 GGCACCTCTGTGGGCATATAT pLKO_005 494 CDS 100% 15.000 10.500 N CEPT1 n/a
7 TRCN0000330813 AGCTCATTCTAATCATCATTA pLKO_005 1385 CDS 100% 13.200 9.240 N CEPT1 n/a
8 TRCN0000035969 CCATCATTGGACTGTCAATAA pLKO.1 421 CDS 100% 13.200 9.240 N CEPT1 n/a
9 TRCN0000103317 CCAAATCTCATCACCATCATT pLKO.1 408 CDS 100% 5.625 3.938 N Cept1 n/a
10 TRCN0000325656 CCAAATCTCATCACCATCATT pLKO_005 408 CDS 100% 5.625 3.938 N Cept1 n/a
11 TRCN0000035973 CCATTGTCAAGACACCAACTA pLKO.1 279 CDS 100% 4.950 3.465 N CEPT1 n/a
12 TRCN0000035972 GTACAAATTACTTCCGTGTAA pLKO.1 940 CDS 100% 4.950 3.465 N CEPT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07592 pDONR223 100% 96.8% 96.8% None (many diffs) n/a
2 ccsbBroad304_07592 pLX_304 0% 96.8% 96.8% V5 (many diffs) n/a
3 TRCN0000479564 CGCGGTAAGCACCTCATGCGCCGC pLX_317 33.5% 96.8% 96.8% V5 (many diffs) n/a
Download CSV