Transcript: Human XM_011540623.2

PREDICTED: Homo sapiens mab-21 like 3 (MAB21L3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAB21L3 (126868)
Length:
2244
CDS:
398..1486

Additional Resources:

NCBI RefSeq record:
XM_011540623.2
NBCI Gene record:
MAB21L3 (126868)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011540623.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424050 GCAGCGGAAATTACATCAAAC pLKO_005 1599 3UTR 100% 10.800 15.120 N MAB21L3 n/a
2 TRCN0000143419 CCTTACTCTGACACGTACAAT pLKO.1 554 CDS 100% 5.625 7.875 N MAB21L3 n/a
3 TRCN0000418555 CATCAAGTCGTTTGGATTTAA pLKO_005 1051 CDS 100% 15.000 10.500 N MAB21L3 n/a
4 TRCN0000141000 CCAGCACTTCCTGAAACACTA pLKO.1 1357 CDS 100% 4.950 3.465 N MAB21L3 n/a
5 TRCN0000142318 GCCTTACTCTGACACGTACAA pLKO.1 553 CDS 100% 4.950 3.465 N MAB21L3 n/a
6 TRCN0000142112 GTGAACATCGACGGAGACATT pLKO.1 788 CDS 100% 4.950 3.465 N MAB21L3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011540623.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09504 pDONR223 100% 99.9% 100% None 669A>G n/a
2 ccsbBroad304_09504 pLX_304 0% 99.9% 100% V5 669A>G n/a
3 TRCN0000479671 CAAGGCAGGTAAAAGGCTGTACAT pLX_317 34.4% 99.9% 100% V5 669A>G n/a
Download CSV