Transcript: Human XM_011541148.2

PREDICTED: Homo sapiens leucine rich repeat containing 8 VRAC subunit B (LRRC8B), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRC8B (23507)
Length:
6477
CDS:
480..2675

Additional Resources:

NCBI RefSeq record:
XM_011541148.2
NBCI Gene record:
LRRC8B (23507)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541148.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000275972 AGCTCTCTTTGGACCATAATA pLKO_005 2458 CDS 100% 15.000 21.000 N LRRC8B n/a
2 TRCN0000276019 ATGCCGTCTGTTACGAGAAAC pLKO_005 796 CDS 100% 10.800 15.120 N LRRC8B n/a
3 TRCN0000166846 CCAGTCATCTTATCACATCTT pLKO.1 518 CDS 100% 4.950 6.930 N LRRC8B n/a
4 TRCN0000167789 GTGACTATTATGATGAACCAT pLKO.1 3356 3UTR 100% 3.000 2.400 N LRRC8B n/a
5 TRCN0000275974 CCGACAGCAGTACTCCTATAT pLKO_005 773 CDS 100% 13.200 9.240 N LRRC8B n/a
6 TRCN0000167445 GATGAAGAATGGGTGACTATT pLKO.1 3344 3UTR 100% 13.200 9.240 N LRRC8B n/a
7 TRCN0000276020 GATGAAGAATGGGTGACTATT pLKO_005 3344 3UTR 100% 13.200 9.240 N LRRC8B n/a
8 TRCN0000275971 TGGGACGTCTTCTGGTATTAC pLKO_005 549 CDS 100% 13.200 9.240 N LRRC8B n/a
9 TRCN0000168793 GAGCTGTCAAACCTTACTCAT pLKO.1 2771 3UTR 100% 4.950 3.465 N LRRC8B n/a
10 TRCN0000172379 CAACTGAGTGTCTAGCCCTAA pLKO.1 3397 3UTR 100% 4.050 2.835 N LRRC8B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541148.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07892 pDONR223 100% 89.9% 88.7% None (many diffs) n/a
2 ccsbBroad304_07892 pLX_304 0% 89.9% 88.7% V5 (many diffs) n/a
3 TRCN0000467277 AGGTCTACGGTTGTTGCAACCCAT pLX_317 15.1% 89.9% 88.7% V5 (many diffs) n/a
Download CSV