Transcript: Human XM_011541212.3

PREDICTED: Homo sapiens low density lipoprotein receptor adaptor protein 1 (LDLRAP1), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LDLRAP1 (26119)
Length:
1081
CDS:
71..862

Additional Resources:

NCBI RefSeq record:
XM_011541212.3
NBCI Gene record:
LDLRAP1 (26119)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541212.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063463 CGACAAGGTGTTTGCATACAT pLKO.1 445 CDS 100% 5.625 7.875 N LDLRAP1 n/a
2 TRCN0000063466 GATGCTGTTCAGCCTCAAGTA pLKO.1 205 CDS 100% 4.950 3.465 N LDLRAP1 n/a
3 TRCN0000063464 GTCCATATACAGGATCTCCTA pLKO.1 403 CDS 100% 2.640 1.848 N LDLRAP1 n/a
4 TRCN0000063465 GAGAAAGAGAAGAGGGACAAA pLKO.1 602 CDS 100% 4.950 2.970 N LDLRAP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541212.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11812 pDONR223 100% 70.4% 69.8% None (many diffs) n/a
2 ccsbBroad304_11812 pLX_304 0% 70.4% 69.8% V5 (many diffs) n/a
3 TRCN0000472559 TTATTCTGCGCAGCTCAGATTGTC pLX_317 56.2% 70.4% 69.8% V5 (many diffs) n/a
Download CSV