Transcript: Human XM_011541426.2

PREDICTED: Homo sapiens potassium voltage-gated channel subfamily D member 3 (KCND3), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCND3 (3752)
Length:
3574
CDS:
146..1309

Additional Resources:

NCBI RefSeq record:
XM_011541426.2
NBCI Gene record:
KCND3 (3752)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045022 CGACAACGACTCGGAGAACAA pLKO.1 592 CDS 100% 4.950 3.465 N KCND3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541426.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06475 pDONR223 100% 59.2% 58.4% None (many diffs) n/a
2 ccsbBroad304_06475 pLX_304 0% 59.2% 58.4% V5 (many diffs) n/a
3 ccsbBroadEn_15486 pDONR223 0% 59% 58.4% None (many diffs) n/a
4 ccsbBroad304_15486 pLX_304 0% 59% 58.4% V5 (many diffs) n/a
5 TRCN0000472207 TAACCCGTTACCCGTCAGACCCAT pLX_317 14.3% 59% 58.4% V5 (many diffs) n/a
Download CSV