Transcript: Human XM_011541447.2

PREDICTED: Homo sapiens chromosome 1 open reading frame 146 (C1orf146), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C1orf146 (388649)
Length:
948
CDS:
268..810

Additional Resources:

NCBI RefSeq record:
XM_011541447.2
NBCI Gene record:
C1orf146 (388649)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541447.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129650 CCACAAAGTTCGATATTCAGA pLKO.1 369 CDS 100% 3.000 4.200 N C1orf146 n/a
2 TRCN0000129786 CGATATTCAGATTCAGTGGAA pLKO.1 379 CDS 100% 2.640 3.696 N C1orf146 n/a
3 TRCN0000128758 CGAAGCCACAAAGTTCGATAT pLKO.1 364 CDS 100% 10.800 8.640 N C1orf146 n/a
4 TRCN0000129052 GACTACCTCCAAACCATACAT pLKO.1 675 CDS 100% 5.625 4.500 N C1orf146 n/a
5 TRCN0000128622 CTGGGTTGTAACTTACGAATA pLKO.1 601 CDS 100% 10.800 7.560 N C1orf146 n/a
6 TRCN0000129097 CCTGGGTTGTAACTTACGAAT pLKO.1 600 CDS 100% 4.950 3.465 N C1orf146 n/a
7 TRCN0000130241 CTTCCAGTACACAACACAGTA pLKO.1 622 CDS 100% 4.950 3.465 N C1orf146 n/a
8 TRCN0000130089 CAAAGACTACCTCCAAACCAT pLKO.1 671 CDS 100% 3.000 2.100 N C1orf146 n/a
9 TRCN0000130395 GCCTGAAGAATGGAAACTGAT pLKO.1 558 CDS 100% 4.950 2.970 N C1orf146 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541447.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05589 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05589 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474622 AATGCTTAAACCACGGCACACCAT pLX_317 85% 100% 100% V5 n/a
Download CSV