Transcript: Human XM_011541576.2

PREDICTED: Homo sapiens peroxisomal biogenesis factor 10 (PEX10), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PEX10 (5192)
Length:
691
CDS:
73..675

Additional Resources:

NCBI RefSeq record:
XM_011541576.2
NBCI Gene record:
PEX10 (5192)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011541576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022323 CACCACACTTGCAGGCTACCA pLKO.1 252 CDS 100% 0.880 0.704 N PEX10 n/a
2 TRCN0000377253 CTCTCAGATGTGGCCTACTTT pLKO_005 226 CDS 100% 5.625 3.938 N PEX10 n/a
3 TRCN0000368928 CGGCTACATGTTGCCTGGTTT pLKO_005 598 CDS 100% 4.950 3.465 N PEX10 n/a
4 TRCN0000022321 CCACACTTGCAGGCTACCAGA pLKO.1 254 CDS 100% 0.880 0.616 N PEX10 n/a
5 TRCN0000318394 CCACACTTGCAGGCTACCAGA pLKO_005 254 CDS 100% 0.880 0.616 N PEX10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011541576.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15522 pDONR223 0% 61.3% 61% None 597_598insTACCTCCGTGTC;600_601ins366 n/a
2 ccsbBroad304_15522 pLX_304 0% 61.3% 61% V5 597_598insTACCTCCGTGTC;600_601ins366 n/a
3 TRCN0000468791 AACTTATTTTGGACTGTCCTGATC pLX_317 35.8% 61.3% 61% V5 597_598insTACCTCCGTGTC;600_601ins366 n/a
Download CSV